We narrowed to 15,955 results for: GRN
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-RDS1a
Plasmid#87385PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g1 gRNA
Plasmid#86005Purposeplasmid vector encoding for U6-driven AAT_g1 gRNADepositorInsertpU6-AAT_g1 sgRNA
UseCRISPRExpressionMammalianPromoterpU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAT_g2 gRNA
Plasmid#86006Purposeplasmid vector encoding for U6-driven AAT_g2 gRNA (Z-allele specific)DepositorInsertpU6-AAT_g2 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pHU6_Ch5_155183064-gRNA-for
Plasmid#81214PurposepHu6-gRNA-NT1_SpecR backbone, gRNA for targeting the 3' region of pCALNL_Ch5 reporterDepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
pHU6_gRNA_Ch10-for2
Plasmid#81209Purposefor targeting Ch10 psuedo gix site in PCDH15 gene (five base pairs from the cas9 site and 3' of gix site)DepositorInserthU6 expression of gRNA
ExpressionMammalianPromoterU6Available SinceNov. 4, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146383)
Plasmid#76329Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001148115)
Plasmid#76326Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001145307)
Plasmid#76327Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
GK gRNA (BRDN0001146936)
Plasmid#76328Purpose3rd generation lentiviral gRNA plasmid targeting human GKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:Asip
Plasmid#60968PurposeExpression vector of rat Asip guide RNADepositorInsertAgouti signaling protein gRNA (Asip Rat)
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-1
Plasmid#60969PurposeExpression vector of rat Kit-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-1
Plasmid#60970PurposeExpression vector of rat Kit-2-1 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pT7-gRNA:kit-2-2
Plasmid#60971PurposeExpression vector of rat Kit-2-2 guide RNADepositorInsertv-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog gRNA (Kit Rat)
UseCRISPRAvailable SinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6_empty-sgRNA(PP7)
Plasmid#232432Purposeempty gRNA backbone which contains the PP7 aptamer in the scaffold tetraloopDepositorInsertPP7-tagged sgRNA scaffold driven by human U6 promoter
UseCRISPRPromoterU6Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-Osp.gRNA-MS2in
Plasmid#229772PurposeContains the U6 promoter and an optimized gRNA backbone inserted with two copies of the MS2 stem loop.DepositorInsertgRNA cassette with two MS2 stem loops
UseCRISPRExpressionMammalianPromoterU6Available SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
Dual-sgRNA_hU6-mU6
Plasmid#154194PurposeLentiviral expression plasmid for two sgRNAs from a hU6 and a mU6 promoter. The cloning site design allows a one-step cloning strategy of both sgRNAs. Expresses a Thy1.1 marker.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceDec. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCFD4-U6:1_U6:3tandemgRNAs
Plasmid#49411Purposeexpression of two gRNAs from Drosophila U6:1 and U6:3DepositorInsertsdU6-1:gRNA
dU6-3:gRNA
UseCRISPRExpressionInsectPromoterdU6-1 and dU6-3Available SinceJan. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only