We narrowed to 13,184 results for: BASE
-
Plasmid#176143PurposeEGFP fused the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Arg65Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Arg65 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(D256A/PAMmut)
Plasmid#176141PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutation Asp256Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutation in Asp256 to Ala, a…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(PAMmut)
Plasmid#176139PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianPromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-POLBHR-eGFP
Plasmid#176064PurposeHomology region +/- 800bp to the transcription start site of POLB, with EGFP inserted in-frame on the N-terminus of POLB, and a mutation in the PAM site used by POLBKO gRNA1 in POLB exon1DepositorInsertEGFP-PolB (POLB Human)
TagsEGFPExpressionMammalianMutationpUC with endogenous SapI mutated out, PAM mutatio…PromoterN/AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RR(S542R/K607R)-NLS(nucleoplasmin)-6xHis (AAS1916)
Plasmid#114076PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RR(S542R/K607R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RR (S542R/K607R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R and K607RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET-28b-T7-hAsCas12a-RVR(S542R/K548V/N552R)-NLS(nucleoplasmin)-6xHis (AAS1897)
Plasmid#114074PurposeT7 promoter bacterial expression plasmid for human codon optimized AsCas12a-RVR(S542R/K548V/N552R) with C-terminal NLS and His-tagDepositorInserthuman codon optimized AsCas12a-RVR (S542R/K548V/N552R) with C-terminal NLS and His-tag
TagsNLS(nucleoplasmin) and 6xHisExpressionBacterialMutationS542R, K548V and N552RAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTU1-A-fbp_RiboJ_GFP+_MGApt_Bba_B0015
Plasmid#107578PurposeB. megaterium DSM319 fbp promoter, GFP+ with malachite green mRNA aptamer for Bacillus cell-free transcription-translation. Bacillus shuttle vector backbone, colE1/AmpR (E. coli), RebB/TetA (Bacillus)DepositorInsertGFP+
UseSynthetic BiologyTagsB. megaterium DSM319 xylA leader sequence (MTSSKI…ExpressionBacterialMutationF64L/ S65T/ Q80R/ F99S/ M153T/ V163APromoterfbp promoter Bacillus megaterium DSM319Available SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBEST-Pl-tetO1-tetR-linker-deGFP-T500 (109p)
Plasmid#70195PurposePost cloned 4-piece from Isothermal/Golden Gate assembly (GGA), using sequences from 2 (PltetO1-UTR1), 3 (tetR+linker from primer extension), 21 (linker from primer extension + deGFP), and 105 (vectorDepositorInserttetR-deGFP fusion
Available SinceMay 19, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJAK080
Plasmid#167279PurposeCodA-based vector for insertion of DNA by recombination downstream of the pyrE gene in C. difficileDepositorTypeEmpty backboneUseE. coli - c. difficile shuttle vectorAvailable SinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pXNubWtgate
Plasmid#105080PurposeYeast mating-based Split Ubiquitin Assay, positive controlDepositorTypeEmpty backboneTagsNubIExpressionYeastAvailable SinceFeb. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
TET1cd-dCas9-IBM1 (D30)
Plasmid#239492PurposeEncodes a CRISPR/dCas9-based fusion protein designed for targeted DNA demethylation.DepositorInsertRPS5A-TET1cd-XTEN80-NLS-dCas9-2xNLS-XTEN16-BFP-IBM1
UseCRISPRExpressionPlantAvailable SinceDec. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
p-att-ef1a-ABE8e-dCas9-BSD
Plasmid#226116PurposeUsing promoter ef1a expresses ABE8e-dCas9 protein with Blasticidin selectionDepositorInsertBSD
UseCRISPRExpressionMammalianAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-SlugABE-NNG-P2A-puro
Plasmid#214354PurposeExpresses SlugABE-NNG and puromycin resistance genesDepositorInsertSlugABE-NNG and puromycin resistance genes
ExpressionMammalianMutationQ782R/S888R/L906R/N984S/E1012K/K1016IAvailable SinceFeb. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pNIR-FbGFPY58/C-PKI
Plasmid#184685PurposeNIR-Fb-based PKA inhibitorDepositorInsertNIR-FbGFPY58/C-PKI
ExpressionMammalianPromoterCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNIR-FbGFPY58/C-JIP
Plasmid#184684PurposeNIR-Fb-based JNK inhibitorDepositorInsertNIR-FbGFPY58/C-JIP
ExpressionMammalianPromoterCMVAvailable SinceJune 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Cerulean3-Cerulean3-FLARE-Cameleon
Plasmid#123353PurposeCyan-fluorescent homoFRET/anisotropy-based genetically encoded calcium indicator.DepositorInsertCerulean3-Cerulean3-FLARE-Cameleon
Tags6xHIS, Cerulean3, T7 tag (gene 10 leader), and Xp…ExpressionMammalianPromoterCMVAvailable SinceJuly 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
R26-EGFP MMEJ donor vector
Plasmid#137926PurposeR0SA26 knock-in vector with microhomology-mediated end-joining(MMEJ)-based methodDepositorInsertSA-EGFP-bpA with micro-homology arms
UseMouse TargetingAvailable SinceMay 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
KA1042_pPB-hCMV*1-Esrrb-IV
Plasmid#124177PurposepiggyBac-based Dox-inducible expression of EsrrbDepositorAvailable SinceMarch 28, 2019AvailabilityAcademic Institutions and Nonprofits only