We narrowed to 10,815 results for: ESP
-
Plasmid#222900PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FKBP ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114DepositorInsertFKBP-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2378-FRB-GPA(V84R)-20-11S
Plasmid#222899PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 11S.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc11S
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2377-FRB-GPA(V84R)-20-114
Plasmid#222898PurposeBiosensor chain detecting rapamycin and responding with split Nanoluciferase reconstitution. FRB ectodomain, human Glycophorin A (GPA) (V84R) scaffold, 20 GS linker, split Nanoluciferase fragment 114.DepositorInsertFRB-GPA(V84R)-20GS-NanoLuc114
TagsMycExpressionMammalianMutationV84R in GPAPromoterCMVAvailable SinceAug. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2085-WT-GPA-NLuc-Biosensor-Retrovirus-TD135
Plasmid#222875PurposeRetroviral vector encoding biosensor chains to detect rapamycin (FRB/FKBP domains) and respond with split NanoLuciferase reconstitution (11S/114 fragment). WT Glycophorin A (GPA) scaffold.DepositorInsertFRB-GPA(WT)-NanoLuc114-T2A-FKBP-GPA(WT)-NanoLuc11S
UseRetroviralTagsMycExpressionMammalianPromoterMSCV LTRAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2132-FKBP-GPA-114-5-CyOFP1
Plasmid#222891PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2127-FRB-GPA-114-20-CyOFP1
Plasmid#222886PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2129-FRB-GPA-114-5-CyOFP1
Plasmid#222888PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 5 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-5GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2128-FRB-GPA-114-10-CyOFP1
Plasmid#222887PurposeBiosensor chain detecting rapamycin and responding with BRET. FRB ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFRB-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2131-FKBP-GPA-114-10-CyOFP1
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1
Plasmid#159531PurposeExpresses Arabidopsis thaliana VERNALIZATION1 in E. coliDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71102
Plasmid#154065PurposeLevel 0 Golden Gate vector; Unmodifed CREDepositorInsertCRE
UseSynthetic Biology; Standard cloning vector used b…MutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
KHBD00016
Plasmid#34178DepositorInsertCG8361 (E(spl)m7-HLH Fly)
UseGateway donor vectorAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEN396 - pCAGGS-Tir1-V5-2A-PuroR TIGRE donor
Plasmid#92142PurposeTargeting vector to introduce an osTir1 expressing cassette at the mouse TIGRE acceptor locus using Puromycin selection (2A-fusion). Auxin-inducible degron system.DepositorInsertosTir1
UseMouse TargetingTagsV5 tagExpressionMammalianAvailable SinceJune 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s ONE-GO
Plasmid#189731PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pFRT-FLAG-HA-(N)-CDK12
Plasmid#231750PurposeExpression in Flp-IN human cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP NeoR
Plasmid#128960PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHS1-M7A,H102A
Plasmid#159171PurposeHuman codon-optimized cytosolic labile heme reporterDepositorInserthHS1-M7A,H102A
ExpressionMammalianMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only