We narrowed to 69,679 results for: TOR
-
Plasmid#233190PurposeRetroviral expression of tagged mNgn2x3FLAGDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pMXs-mNgn2-x1HA
Plasmid#233191PurposeRetroviral expression of tagged mNgn2x1HADepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_4
Plasmid#217431PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgTK2_5
Plasmid#217432PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human TK2DepositorAvailable SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgSHMT2
Plasmid#217435PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human SHMT2DepositorInsertsgRNA targeting SHMT2 (SHMT2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
CAG-mCherry
Plasmid#229135PurposeRetrovirus driving mCherry reporterDepositorInsertmCherry
UseRetroviralExpressionMammalianAvailable SinceJan. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol1 - 14xUAS:CaSR-EGFP
Plasmid#191502PurposeA UAS construct used to create transgenic fish that express CaSR-EGFP when crossed to a fish carrying a Gal4.DepositorInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol1 transgenes…Promoter14X UASAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK2043-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9
Plasmid#223163Purpose2nd gen. AAV backbone for dSaCas9 (endonuclease dead Cas9 from Staphylococcus aureus) and Sa-gRNA ScaffoldDepositorTypeEmpty backboneUseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)Available SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET41SIII-ATF6(1-373)
Plasmid#171074PurposeExpresses of ATF6α(1-373) in bacteriaDepositorAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-ZGLP1
Plasmid#222926PurposePiggyBac transposon plasmid for doxycycline inducible expression of ZGLP1DepositorInsertZGLP1 (ZGLP1 Human)
ExpressionMammalianAvailable SinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pro::EX1-2(intΔNACs&ΔMYBs):GFP
Plasmid#218572PurposeTranscriptional reporter for ARF7 promoterDepositorInsertAT5G20730 (NPH4 Mustard Weed)
ExpressionPlantMutationMutation genomic sequence 85nt, 86nt from TA to C…Available SinceJuly 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ARMS1-ProLink2-MRGPRX3
Plasmid#213962PurposeExpresses MRGPRX3 in mammalian cellsDepositorAvailable SinceMay 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMamCol1
Plasmid#215184PurposeAllows for stable expression of recombinant (tagged/untagged) proteins in AAVS1 locus of Human cells and transient Protein Expression in E. coliDepositorInserttsPurple
UseAAV, CRISPR, and Synthetic Biology ; Recombinant …TagsSNAC-StrepII tagExpressionBacterial and MammalianPromoterTetON 3G Bidirectional for Mammalian and Trc with…Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Hyg-BFP-P2A-ppViperin
Plasmid#217481PurposeExpression of Blue Fluorescent Protein - P2A - full length protein kinase R from chinook salmonDepositorInsertBFP-P2A-otPKRFL
ExpressionMammalianPromoterCMVAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF702
Plasmid#209650PurposeSuicide plasmid carrying a neomycin resistance marker flanked by homologous regions of the Mth60-fimbria encoding operon of Methanothermobacter thermautotrophicusDepositorInsertsDownstream homologous region
thermostable neomycin phosphotransferase gene
Upstream homologous region
Available SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_EF1a_DIO_HA/FLAG_muMASS
Plasmid#213393PurposeuMASS_1 opioid sensor. AAV Virus production for Cre dependent expressionDepositorInsertuMASS_1
UseAAV and Cre/LoxExpressionMammalianAvailable SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hsyn_HA_Flag-uMASS_LF
Plasmid#209761PurposeAAV virus production for neuonal expression of uMASS (loss-of-function) under hSyn promoterDepositorInsertuMASS_LF
UseAAVExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pS44i8GH-1
Plasmid#207525PurposeConditionally-replicating in Pseudomonas vector, high-copy-number; oriV(pRO1600/ColE1), xylS (cured of BsaI-sites), Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP; SmR/SpRDepositorInsertoriV(pRO1600/ColE1), xylS, Pm→repA, P14b with a translational BCD2 coupler from BG35 (53)→msfGFP;
UseCRISPR; Pseudomonas vectorAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only