We narrowed to 10,841 results for: esp
-
Plasmid#222890PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 10 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-10GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
L2130-FKBP-GPA-114-20-CyOFP1
Plasmid#222889PurposeBiosensor chain detecting rapamycin and responding with BRET. FKBP ectodomain, human Glycophorin A (GPA) scaffold, 20 GS linker, split Nanoluciferase fragment 114, 20 GS linker, CyOFP1 protein.DepositorInsertFKBP-GPA-20GS-NanoLuc114-20GS-CyOFP1
TagsMycExpressionMammalianPromoterCMVAvailable SinceJuly 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQE30-VRN1
Plasmid#159531PurposeExpresses Arabidopsis thaliana VERNALIZATION1 in E. coliDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
EC71102
Plasmid#154065PurposeLevel 0 Golden Gate vector; Unmodifed CREDepositorInsertCRE
UseSynthetic Biology; Standard cloning vector used b…MutationAll BsaI, Esp3I and BPiI restriction sites were r…Available SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 N184X
Plasmid#92373PurposeInducible expression of M87 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP S245X with 5'UTR
Plasmid#92376PurposeInducible expression of S245X spastin M1 and M87 in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M87 S245X
Plasmid#92374PurposeInducible expression of M87 S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-460 bp deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M1 S245X
Plasmid#92372PurposeInducible expression of M1S245X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, S245XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTRE/SP M1 N184X
Plasmid#92371PurposeInducible expression of M1 N184X spastin in mammalian cellsDepositorInsertspastin (SPAST Human)
ExpressionMammalianMutation1-194 bp of 5'UTR deleted, N184XPromoterTet-responsive P tightAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
KHBD00016
Plasmid#34178DepositorInsertCG8361 (E(spl)m7-HLH Fly)
UseGateway CloningAvailable SinceJan. 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLVX-CMV-Galpha-s ONE-GO
Plasmid#189731PurposeGPCR/G protein BRET biosensorDepositorInsertsUseLentiviralAvailable SinceJan. 19, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti-5HRE-GFP PuroR
Plasmid#128958PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
YY171: pPB_NFκB::GFP-GEMINI(A)_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228883PurposePiggyBac plasmid expressing the GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
JL054: pPB_NFκB::GFP-GEMINI(A)-P1N4_TRE::HaloTag-GEMINI(A)_UbC::rtTA3-IRES-PuroR
Plasmid#228884PurposePiggyBac plasmid expressing the destabilized GFP-GEMINI(A) under the control of a synthetic NFκB-responsive promotor, and rtTA3 and PuroR under the control of a UbC promoter.DepositorInsertGFP-fused GEMINI(A), HaloTag-fuse GEMINI(A)
ExpressionMammalianPromoterpNFκB; TREAvailable SinceFeb. 3, 2026AvailabilityAcademic Institutions and Nonprofits only -
ARR3tk-eGFP/SV40-mCherry
Plasmid#132360PurposeTo measure transcriptional activity of Androgen ReceptorDepositorInsertAR responsive elements (AR Human)
UseLentiviralAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFRT-FLAG-HA-(N)-CDK12
Plasmid#231750PurposeExpression in Flp-IN human cellsDepositorAvailable SinceMay 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-5HRE-GFP NeoR
Plasmid#128960PurposeLentiviral plasmid for expression of hypoxia-responsive enhanced green fluorescent proteinDepositorInsert5X HRE of VEGF (VEGFA Human)
UseLentiviralTagsd2EGFPExpressionMammalianPromoterminimal CMV promoterAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
hHS1-M7A,H102A
Plasmid#159171PurposeHuman codon-optimized cytosolic labile heme reporterDepositorInserthHS1-M7A,H102A
ExpressionMammalianMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterCMVAvailable SinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only