We narrowed to 11,688 results for: nts
-
Plasmid#202656PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from Agrostemma githago cytosolic LysRS predicted to be re-targeted to mitochondria
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Silene_conica _TyrRS_MitoTP_pK7FWG2
Plasmid#202657PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from Silene conica cytosolic TyrRS predicted to be re-targeted to mitochondria
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Silene_vulgaris _TyrRS_MitoTP_pK7FWG2
Plasmid#202658PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from Silene vulgaris cytosolic TyrRS predicted to be re-targeted to mitochondria
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Silene_conica _PheRS_MitoTP_pK7FWG2
Plasmid#202659PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from organellar Silene conica PheRS predicted to be targeted to mito
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Silene_conica _PheRS_PlastidTP_pK7FWG2
Plasmid#202660PurposeDetermine where transit peptide targets GFP in N. benthamianaDepositorInsertN-terminal transit peptide from organellar Silene conica PheRS predicted to be targeted to plastid
TagsGreen Florescent ProtienExpressionPlantAvailable SinceAug. 10, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
ExpressionBacterialPromoterIPTG inducible lac promoterAvailable SinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-Csy4
Plasmid#161763PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x Csy4-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTRANS-Pho2-1/2-2-tRNA
Plasmid#161762PurposepTRANS T-DNA vector with nptII selection and 35S:Cas9 with 6x tRNA-spliced gRNAs and rolD:TREX2 targeting the four MsPho2-1abcd and MsPho2-2abcd genes in alfalfa (pTRANS_220 - #91113)DepositorInsertCas9 and gRNAs
ExpressionPlantPromoterCmYLCV PromoterAvailable SinceMay 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPO794
Plasmid#195303PurposepBAD322-MycaIDCas-ΔCas6-RGR-PaqCI, arapBAD promoter expressing type I-D Cascade of McCAST (Tn7575) without cas6 gene and ribozyme flanked PaqCI entry site.DepositorInsertMcCAST Cascade Δcas6 and ribozyme flanked entry site
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPO812
Plasmid#195306PurposepBAD322-MycaIDCas-ΔCas6-RGR-lacZs, arapBAD promoter expressing type I-D Cascade of McCAST (Tn7575) without cas6 gene and ribozyme flanked lacZ spacer 5.DepositorInsertMcCAST Cascade Δcas6 and ribozyme flanked lacZ spacer 5
ExpressionBacterialPromoterArabinose inducible arapBADAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i1-14-GFP11
Plasmid#180344Purposemammalian expression of human SEPT9_i1 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP10
Plasmid#180345Purposemammalian expression of human SEPT9_i3 fused to GFP10DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV_SEPT9_i3-14-GFP11
Plasmid#180346Purposemammalian expression of human SEPT9_i3 fused to GFP11DepositorAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAVS1-TRE3G-NODALvar-matMYC
Plasmid#115641PurposeFor targeted integration and inducible expression of a human NODAL splice variant (with an N-terminal MYC tag on the mature peptide) using doxycyclineDepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only