We narrowed to 37,504 results for: Ran;
-
Plasmid#27192DepositorInsertZinc finger array targeting cftr (cftr Zebrafish)
UseZebrafish targetingAvailable SinceFeb. 8, 2011AvailabilityAcademic Institutions and Nonprofits only -
pTol2 - myo6b:CaSR-EGFP, cryaa:mCherry
Plasmid#191500PurposeGROW AT 30 DEGREES. A construct used to create transgenic fish that express CaSR-EGFP in hair cells and an mCherry marker in the lens of the eyeDepositorInsertCaSR-EGFP-SV40
UseCreation of transgenic fish using tol2 transgenes…Promotermyo6bAvailable SinceDec. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-NOG(AtUBI10)
Plasmid#202016PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-sfGFP-VP64-GB1) under the control of the AtUBI10 promoter.DepositorInsertsdCas9-24XGP41
NbGP41P-sfGFP-VP64-GB1
TagsGB1 and sfGFPExpressionPlantPromoterAtUBI10Available SinceAug. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-MYC
Plasmid#192899PurposeBarcoded piggybac transposon vector with Dox-inducible expression of MYCDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAF92
Plasmid#135929PurposeAll-in-one Sleeping Beauty vector for Expression for Tasmanian devil mCherry-TNFSF9 (type II transmembrane) fusion protein. Multiple cloning sites to swap genes-of-interest (i.e. TNFSF9).DepositorInsertmCherry fused to TNFSF9
UseTransposonTagsmCherryExpressionMammalianPromoterEF1aAvailable SinceJan. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET24a-VHH-tev-APEX2
Plasmid#117751PurposeBacterial expression of a functionalized anti-GFP (VHH) nanobody fused to ascorbate peroxidase 2. VHH-APEX2 also contains a T7, HA, BAP, tev cleavage site and His6 epitopeDepositorInsertanti-GFP nanobody fused to a T7, tev site, APEX2, HA, BAP and His6 epitope
TagsBAP, HA, His6, and T7ExpressionBacterialPromoterT7Available SinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pM-ErbB4-delta-kinase
Plasmid#17800DepositorInsertErbB4 (ERBB4 Human)
TagsGAL4-BDExpressionMammalianMutationCarboxy-terminal fragment, amino acids 988-1292, …Available SinceMay 9, 2008AvailabilityAcademic Institutions and Nonprofits only -
SuExp His-Myc-mPLD3
Plasmid#173853PurposeProtein expression plasmid for recombinant His-Myc tag mouse PLD3DepositorInsertPLD3 (Pld3 Mouse)
Tags6xHis, Myc, Factor X cleavableExpressionMammalianMutationintracellular and transmembrane domain truncated,…PromoterCMVAvailable SinceJan. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
p2XStrep-ATIC
Plasmid#125685Purposeexpresses human ATIC protein with an N-terminal 2XStrep affinity tagDepositorAvailable SinceMay 31, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFS_0414_pET30_MCS-BBaJ23100-LuxR-B0015term-pLux rR-Fluc-rrnBterm-pCat-tetR-Term-ptetA-Rluc-rrnBterm_FsRT-Cas1-Cas2_ARRAY2_FaqI
Plasmid#117005PurposeExpresses FsRT-Cas1-Cas2 under pT7lac, Fluc under pLuxR and Rluc under ptetA promoter, encodes FsCRISPR array 2, compatible with SENECA acquisition readoutDepositorInsertFusicatenibacter saccharivorans RT-Cas1-Cas2
ExpressionBacterialPromoterT7Available SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-Blast SHMT2res
Plasmid#106301PurposeExpresses SHMT2DepositorInsertserine hydroxymethyltransferase 2 (SHMT2 Human)
UseRetroviralExpressionMammalianMutationSilent mutations destroy sgRNA targeting sitesAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTK165_Mem-mCherry-4.1G-CTD
Plasmid#46362DepositorInsert4.1G C-terminal domain (EPB41L2 Human)
TagsMem (N-terminal 20 amino acids of neuromodulin fo…ExpressionMammalianMutationC-terminal domain from 886-1005 amino acidsPromoterCMVAvailable SinceAug. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pET21c-IF3mt
Plasmid#31078DepositorInsertMature form human mitochondrial translational initiation factor 3 (MTIF3 Human)
TagsHisExpressionBacterialMutationIncludes coding sequence for the mature form. Ami…Available SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPB-cT3G-cERP2-HOPX
Plasmid#192923PurposeBarcoded piggybac transposon vector with Dox-inducible expression of HOPXDepositorAvailable SinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCALNL-Rheb(S16H)
Plasmid#194204PurposeCre/LoxP-dependent expression of a constitutively active form of Rheb (S16H). Expression of Cre excises a STOP codon before Rheb(S16H), facilitating expression of a constitutively active form of Rheb.DepositorInsertRas Homolog Enriched Protein in Brain (S16H) (RHEB Human)
UseCre/LoxExpressionMammalianMutationS16HAvailable SinceJan. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAdCMV/V5-DEST-S727D-STAT3-3xFlag
Plasmid#99263PurposeAdenoviral vector encoding Flag-tagged murine STAT3 (S727D)DepositorInsertSignal transducer and activator of transcription 3 - S727D (Stat3 Mouse)
UseAdenoviralTags3x-FlagMutationS727DPromoterCMVAvailable SinceJan. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAD-CMV-STAT5A-DNL-CMV-GFP
Plasmid#83253PurposeAdenoviral expression of STAT5A dominant negative with co-expression of GFPDepositorInsertsUseAdenoviralMutationC-terminal deletion of 351 nucleotides (dominant …PromoterCMVAvailable SinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-kanMX6-PGAL1-GST
Plasmid#41611DepositorInsertGAL1 promoter (GAL1 Budding Yeast)
UseYeast genomic targetingTagsA. gossypii translation elongation factor 1a gene…Available SinceDec. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCMV Lex VP16 (F442A) HA (P#1710)
Plasmid#14595DepositorInsertLexA
TagsHA and VP16 (F442A)ExpressionMammalianMutationThe VP16 sequence contains an F442A mutation. The…Available SinceJune 30, 2008AvailabilityAcademic Institutions and Nonprofits only