We narrowed to 5,868 results for: SPI
-
Plasmid#115191PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PARK7E163K into any mammalian cell (when using sgRNA seq agtacagtgtagccgtgatg)DepositorInsertCR (CRISPR/Cas9-resistant)-PARK7E163K (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationc.150G>A (silent when translated to protein, c…PromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2
Plasmid#115199PurposeLentiviral transduction and expression of a CRISPR/Cas9-resistant PDHA2 into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2WT (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLEX307_CR-PDHA2S291A
Plasmid#115203PurposeLentiviral transduction and expression of CRISPR/Cas9-resistant PDHA2S291A into any mammalian cell (when using sgRNA 5'-ATGTAATGACGTGATCCGAG-3')DepositorInsertCR (CRISPR/Cas9-resistant)-PDHA2S291A (PDHA2 Human)
UseLentiviralMutationc.321C>T (silent when translated to protein, c…PromoterEF1alphaAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 2573
Plasmid#107233PurposeshRNA 2573. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLT3REVIR_MARK3 1122
Plasmid#107232PurposeshRNA 1122. Do not use Evos or Acurri on these cells. Assess by FACS specifically with Venus and DsRed lazers. Tet-ON-all-in-oneDepositorAvailable SinceMarch 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterhuman U6, mouse U6, human H1, human 7SKAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-45b-mEGFP-HMGB1-WT
Plasmid#194543PurposeBacterial Expression of 6xHis mEGFP-HMGB1 WT Fusion ProteinDepositorAvailable SinceFeb. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-FOXL2-WT
Plasmid#194584PurposeMammalian Expression of mEGFP-FOXL2 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-mEGFP-HMGB1-WT-Full-length
Plasmid#194548PurposeMammalian Expression of mEGFP-HMGB1 WT Fusion ProteinDepositorAvailable SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUCM-CLYBL-NGN2-BRN3A
Plasmid#165597PurposeDonor construct for insertion of NGN2 and BRN3A into the CLYBL safe harbor site. This is an all-in-one doxycycline-inducible construct, enabling iPSC differentiation into peripheral sensory neurons.DepositorInsertsUseCRISPR and TALENExpressionMammalianPromoterCAG, EF-1alpha, Endogenous CLYBL (splice acceptor…Available SinceMarch 3, 2021AvailabilityAcademic Institutions and Nonprofits only