We narrowed to 11,081 results for: aga
-
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
pAAV-AICD-NES-IRES-hrGFP
Plasmid#107544PurposeAAV-mediated expression of AICD (last 50 amino acids of APP) with Nuclear Export Signal (NES: CTCCCTCCACTAGAGCGACTAACCTTA) at C-term end and IRES-mediated co-expression of hrGFPDepositorAvailable SinceMay 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
HK2 gRNA (BRDN0001162236)
Plasmid#76309Purpose3rd generation lentiviral gRNA plasmid targeting human HK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001145259)
Plasmid#77734Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CSF1R gRNA (BRDN0001146892)
Plasmid#77039Purpose3rd generation lentiviral gRNA plasmid targeting human CSF1RDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001146399)
Plasmid#76853Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TTN gRNA (BRDN0001148106)
Plasmid#76854Purpose3rd generation lentiviral gRNA plasmid targeting human TTNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MAP2K4 gRNA (BRDN0001148854)
Plasmid#76652Purpose3rd generation lentiviral gRNA plasmid targeting human MAP2K4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ABL1 gRNA (BRDN0001147538)
Plasmid#77735Purpose3rd generation lentiviral gRNA plasmid targeting human ABL1DepositorAvailable SinceJuly 13, 2016AvailabilityAcademic Institutions and Nonprofits only -
rTTA-gRNA-AAV
Plasmid#213036PurposeThis vector contains rTTA expressed under CMV promoter and gRNA expressed under U6 promoterDepositorInsertrTTA-T2A-mCherry
UseAAV and CRISPRPromoterCMVAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hBIRC2_2b)-PGKpuro2ABFP-W
Plasmid#208417PurposeLentiviral gRNA plasmid targeting human BIRC2 gene, co-expression of BFP tagDepositorInsertBIRC2 (BIRC2 Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hIKBKG_2m)-PGKpuro2ABFP-W
Plasmid#208411PurposeLentiviral gRNA plasmid targeting human IKBKG gene, co-expression of BFP tagDepositorInsertIKBKG (IKBKG Human)
UseCRISPR and LentiviralExpressionMammalianMutationN/APromoterhuman U6Available SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
sgMST1/2-2
Plasmid#229430Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg3_pX330
Plasmid#127340PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #3DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA (Cdk13 Mouse)
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD R2187A
Plasmid#169827PurposeExpresses C-terminal flag-tagged CAD with mutation at reported trimerization interface of the ATCase domain of CADDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationR2187A, T456A S1406A S1859A; TCCC -> AGTC sile…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD H1734A H1741A
Plasmid#169830PurposeExpresses C-terminal flag-tagged CAD with mutations at reported dimerization interface of the DHOase domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationH1734A H1741A; TCCC -> AGTC silent mutations a…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop2
Plasmid#169832PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids R1398 - S1407; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only