We narrowed to 1,976 results for: cas9 expression vector
-
Plasmid#184885PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pECNUS3
Plasmid#184886PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pECNUS1
Plasmid#184884PurposeABE cloning vector, insertion of gRNA sequence via Golden Gate with BsaI and T4 ligase, blue-white screening. Replicates in E.coli and Agrobacterium, binary vector for Agrobacterium T-DNA deliveryDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterRPS5AAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
p32Lb
Plasmid#158154PurposeConstruct conventional Cpf1 vectors that uses U3p and UBI10p to express single crRNA (or PTC/CA) and FnCpf1, respectively. For plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
p32Fn
Plasmid#158153PurposeConstruct conventional Cpf1 vectors that uses U3p and UBI10p to express single crRNA (or PTC/CA) and LbCpf1, respectively. For plant genome editing.DepositorTypeEmpty backboneUseCRISPRExpressionPlantMutationRice codon optimizedAvailable SinceJan. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCB591
Plasmid#141096PurposeE. coli-Lactobacilli shuttle vector for recombineering template cloningDepositorTypeEmpty backboneExpressionBacterialAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKM197
Plasmid#132665PurposepyrE-targeted CRISPR-Cas9 control plasmid. Cas9 expression is controlled by the xylR promoter and results in improved conjugation efficiency. Induction with xylose results in a pyrE mutant.DepositorInsertUpstream & Downstream pyrE deletion region
UseE. coli - c. difficile shuttle vectorAvailable SinceOct. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-Stuffer
Plasmid#106248PurposeDestination vector for U6::gRNA expression cassetteDepositorTypeEmpty backboneUseAAVAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSEVA231-CRISPR
Plasmid#138712PurposePlasmid designed to clone a specific spacer into BsaI sites to generate a CRISPR ArrayDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialAvailable SinceSept. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMLS234
Plasmid#73682PurposeSapTrap 3-site Destination vector for N-terminal GFP tagging with embedded Cbr-unc-119 selectable markerDepositorInsertGFP + Cbr-unc-119
UseCRISPR and Cre/LoxTagsGFPExpressionWormAvailable SinceApril 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-SCP1-dSa VPR mini.-2X snRP-1 Afp
Plasmid#99696PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Afp, vector allows for strong activation of mouse Afp, can be packaged and delivered as AAVDepositorAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
lenti dCAS-VP64_Blast
Plasmid#61425Purpose3rd generation lenti vector encoding dCAS9-VP64 with 2A Blast resistance marker (EF1a-NLS-dCas9(N863)-VP64-2A-Blast-WPRE)DepositorHas ServiceLentiviral PrepInsertdCAS9(D10A, N863A)-VP64_2A_Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A in Cas9PromoterEF1AAvailable SinceDec. 19, 2014AvailabilityAcademic Institutions and Nonprofits only -
Blat-BSD
Plasmid#163791PurposeThe plasmid expresses human codon-optimized BlatCas9, gRNA expression elements and blasticidin resistence gene.DepositorTypeEmpty backboneUseAAV and CRISPRExpressionMammalianAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHSN501
Plasmid#50589PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses zCas9D10A, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistanceDepositorInsertszCas9D10A
gRNA scaffold
UseCRISPR; Plant expressionTags3xFLAG and NLSMutationCas9D10A nickase, was derived from the zCas9 and …Promoter2×35Sp and AtU6-26pAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS11
Plasmid#107925PurposeamdS based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only