We narrowed to 7,219 results for: cas9 plasmid
-
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pLL8 lenti-D10Acas9-3xflag-blast
Plasmid#112134Purposelenti vector encoding D10Acas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-D10ACas9-3Xflag-T2A-Blast-WPRE)DepositorInsertD10Acas9-3xflag-blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A mutant in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJEP304-pAAV-EFS-dSaCas9-VP64-pA
Plasmid#113679PurposeA EFS driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 SV40-CMV-SaCas9-3xNLS
Plasmid#78601PurposeAAV vector containing SaCas9DepositorInsertSV40-CMV-SaCas9-3xNLS
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoterSV40, CMV promotersAvailable SinceDec. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianAvailable SinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP302-pAAV-CMV-dSaCas9-KRAB-pA
Plasmid#113677PurposeA CMV driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceFeb. 14, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP305-pAAV-EFS-dSaCas9-KRAB-pA
Plasmid#113681PurposeA EFS driven de-catalyzed SaCas9 fused to KRAB domain for inhibition of transcription in targeted region.DepositorInsertde-catalyzed SaCas9
UseAAV and CRISPRTagsKRAB and NLSAvailable SinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJEP303-pAAV-CMV-dSaCas9-VP64-pA
Plasmid#113678PurposeA CMV driven de-catalyzed SaCas9 fused to VP64 domain for increased transcription in targeted regionDepositorInsertde-catalyzed SaCas9
UseAAV, CRISPR, and Synthetic BiologyTagsNLS and VP64Available SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
Plasmid#78606PurposepZac2.1 CMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2DepositorInsertCMV173-SaCas9-U6-SaDMDR7-U6-SaDMDL2
UseAAV and CRISPRTagsHA tagExpressionMammalianPromoter173CMV, U6Available SinceDec. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-spCas9
Plasmid#231404PurposeExpresses spCas9 from hSyn promoterDepositorAvailable SinceOct. 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCMV-dSaCas9-VP64-pU6-sgRNA
Plasmid#158990PurposeVector G encodes pAAV-pCMV-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in mammalian cellsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-KRAB-pU6-sgRNA
Plasmid#158988PurposeVector E encodes pAAV-pMecp2-dSaCas9-KRAB-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR interference in neuronsDepositorInsertdSaCas9-KRAB
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP64-pU6-sgRNA
Plasmid#158972PurposeVector C encodes pAAV-pMecp2-dSaCas9-VP64-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP64
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceSept. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pHR-PGK- dCas9-SunTag-P2A-HygR
Plasmid#193137PurposeExpresses dCas9 fused to the SunTag scaffoldDepositorInsertdCas9-SunTag-T2A-HygR
UseLentiviralPromoterPGKAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pMecp2-dSaCas9-VP160-pU6-sgRNA
Plasmid#158987PurposeVector D encodes pAAV-pMecp2-dSaCas9-VP160-spA-pU6-sgRNA (BsaI) transgenes for AAV packaging and expression of CRISPR activator in neuronsDepositorInsertdSaCas9-VP160
UseAAV and CRISPRExpressionMammalianPromoterpMecp2Available SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only