We narrowed to 20,111 results for: REN
-
Plasmid#112133Purposelenti vector encoding dcas9-3xflag with T2A Blastcidin resistance marker (EF1a-NLS-dCas9-3Xflag-T2A-Blast-WPRE)DepositorInsertdCas9(D10A, N863A)-T2A-Blast
UseCRISPR and LentiviralExpressionMammalianMutationD10A and N863A mutants in Cas9PromoterEF1aAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
TetO-CDK5RAP2
Plasmid#202840PurposeDoxycycline inducible expression of CDK5RAP2 cDNADepositorAvailable SinceJuly 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On shYap1-5
Plasmid#193671PurposeTet inducible knockdown of Yap1DepositorInsertYap1 (Yap1 Mouse)
UseLentiviralAvailable SinceDec. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
P-rTetO-mCherry-T2A-RPL22-1xV5
Plasmid#170325PurposeTetracycline-inducible expression of V5 and mCherry tagged RPL22DepositorAvailable SinceMay 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
TFORF2195
Plasmid#142181PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF0275
Plasmid#142582PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTarget
Plasmid#214052PurposeExpresses target sequence for Haliangium type III CRISPR-Cas complex; identical to pNon-target (Addgene plasmid # 214053) but contains a protospacer.DepositorInsertTarget sequence
UseTarget rna plasmidExpressionBacterialPromotertrc promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHochTypeIII
Plasmid#214039PurposeBacterial expression plasmid for Haliangium ochraceum type III CRISPR-Cas complex; contains csb2, a minimal CRISPR array with a pTarget spacer, cmr1-6DepositorInsertCas10
UseCRISPRMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
TFORF0702
Plasmid#144361PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLT 651
Plasmid#59998PurposeExpresses a hybrid dsRNA corresponding to the Caenorhabditis elegans klp-16/him-8 genes in bacteria; ingestion of the bacteria by C elegans produces an RNAi response & leads to more male progenyDepositorExpressionBacterialMutationpartial genomicAvailable SinceApril 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
MultiMate-Cell-cycle
Plasmid#206280PurposeExpression of a FUCCI cell cycle sensor with a H2B iRFP713 chromatin reporter. Can be used to generate recombinant baculovirus particles.DepositorInsertH2B iRFP713, mAG-hGeminin, mKO2-hCdt1
UseRecombinant baculovirus productionExpressionMammalianAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-Ef1a-SOX2-3xFLAG
Plasmid#216197PurposeOverexpress human SOX2 in HEK 293T cells for use in whole cell extract EMSAsDepositorInsertSOX2 (SOX2 Human)
UseLentiviralAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXL002-ishRNA-beta-catenin-1
Plasmid#36297DepositorInsertshRNA of beta-catenin-1 (CTNNB1 Human)
UseLentiviral and RNAiTagsIRES-RFP-PuroExpressionMammalianPromoterTetO-H1Available SinceAug. 7, 2012AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-FLEX-tdTomato-WPRE
Plasmid#51505PurposeCan be used to generate AAV virus that will express tdTomato in the presence of Cre in neurons from the synapsin promoterDepositorInserttdTomato
UseAAVPromoterphSyn1Available SinceMay 1, 2014AvailabilityAcademic Institutions and Nonprofits only -
VE-cad KI gRNA1
Plasmid#92310PurposeCRISPR-GFP-gRNA for cutting VEcadDepositorAvailable SinceJuly 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3 2xSTREP Cyclin F(LP35/36AA)
Plasmid#236467Purposetransient overexpression of Cyclin F in mammalian cellsDepositorInsertCyclin F (CCNF Human)
Tags2xSTREPExpressionMammalianMutation(LP35/36AA) first two amino acids of the F-box do…Available SinceMay 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Dre-nls (JDW 1131)
Plasmid#229809PurposeA CAGGS-driven dre recombinase followed by a c-terminal 1x nls sequenceDepositorInsertDRE recombinase-nls
TagsSV40 NLSExpressionMammalianPromoterCAGAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0725
Plasmid#143071PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF1037
Plasmid#144269PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only