We narrowed to 60,703 results for: promoter
-
Plasmid#254714PurposeThis AAV vector contains an enhancer that drives mCherry expression in spinal cord skeletal motor neurons of gamma subtype. Specificity of vector not characterized outside the mouse spinal cord.DepositorInsertPard3b enhancer, mini promoter, synthetic intron, mCherry, WPRE (Pard3b Mouse, Synthetic)
UseAAV and Mouse TargetingExpressionMammalianAvailable SinceApril 27, 2026AvailabilityAcademic Institutions and Nonprofits only -
pEHE51
Plasmid#250522PurposeVector for sgRNA expression in Acinetobacter baumannii (CRISPRi). Modified version of pYDE007 (Plasmid #194152) made Golden Gate compatible (BsaI) for sgRNA oligo insertion.DepositorInsertTwo BsaI sites (T-BsaI-BfuI-BsaI-A) inserted between the J23119 promoter and dCas9 handle/gRNA scaffold
ExpressionBacterialPromoterJ23119Available SinceJan. 21, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV_ER-RE_MLPmin_BC1064-luc2
Plasmid#227110PurposeEstrogen receptor response element for luciferase and barcode assays; barcode BC1064DepositorInsert12x clustered ER response element linked to MLP minimal promoter driving barcode 1064 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas9-sggfp
Plasmid#236184PurposeThe plasmid pQdCas9-sggfp expresses the dCas9 endonuclease and the sgRNA targeting the gfp gene.DepositorInsertQuorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas9, and sgRNA for GFP gene
PromoterQuorum sensing promoterAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_GR-RE_MLPmin_BC1093-luc2
Plasmid#227113PurposeGlucocorticoid receptor response element for luciferase and barcode assays; barcode BC1093DepositorInsert12x clustered GR response element linked to MLP minimal promoter driving barcode 1093 and a luciferase reporter gene
UseAAVExpressionMammalianAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_535-888 USP7
Plasmid#131248PurposeMammalian expression of the USP7 UBL1-3 domains with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_535-1102 USP7…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_884-1102 USP7
Plasmid#131249PurposeMammalian expression of the USP7 UBL4-5 domains with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationEncodes USP7 UBL domains 4-5 (USP7 amino acids 88…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsExpressionYeastAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEMS2115
Plasmid#49140PurposeThe plasmid contains the Pleaides (Ple) MiniPromoter Ple155 derived from the human PCP2 gene and designed for expression in ON Bipolar cells of the retina.DepositorInsertssAAV-Ple155-emGFP-WPRE
UseAAVExpressionMammalianPromoterMiniPromoter Ple155 from the human PCP2 geneAvailable SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV.CAGFLEX.(cyto).iATPSnFR2.S29W.A95K.HaloTag
Plasmid#209655PurposeExpression of iATPSnFR2, high affinityDepositorHas ServiceAAV5InsertiATPSnFR2.S29W.HaloTag
UseAAVMutationS29W.A95KPromoterCAGAvailable SinceNov. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pENTR221 UBR5 ∆PABC
Plasmid#81064PurposeGateway entry vector encoding full length UBR5 Y2402A/K2415A (∆PABC)DepositorInsertUbiquitin protein ligase E3 component N-recognin 5 (UBR5) ∆PABC (UBR5 Human)
UseCloningMutationY2402A and K2415A (bp t7204g, a7205c, t7206c, a72…PromoterN/AAvailable SinceJan. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSAD-5PSD95-EGFP-SynPhRFP
Plasmid#217979PurposeG-Deleted Rabies genomic plasmid to express 5PSD95-EGFP and SynPhRFPDepositorUseG-deleted rabiesTagsEGFP and RFPPromoterNoneAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
KG#62
Plasmid#110874PurposeExpresses the C. elegans acy-1 cDNA pan-neuronallyDepositorInsertsrab-3 promoter
acy-1 cDNA
unc-54 3' control region with 1 intron just upstream and 1 intron in control region
ExpressionBacterialAvailable SinceJune 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(C)
Plasmid#236042PurposeThe plasmid pQdCas12a.sggfp(C) expresses the dCas12a endonuclease and the sgRNA (design C) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (C) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLX304-VHLdeltaB-IRES-GFP
Plasmid#187642PurposeMutant VHL Expression vector with GFPDepositorInsertVHL (VHL Human)
UseLentiviralExpressionMammalianMutationdeletion of amino acids 91 to 121Available SinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCK036 desmaMCS:minCerulean,cryaa:Venus
Plasmid#195981PurposeExpression constructDepositorInsertdesmin a regulatory elements, mouse beta-globin minimal promoter mCerulean, cryaa Venus (desma Zebrafish)
UseOtherAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_535-775 USP7
Plasmid#131247PurposeMammalian expression of the USP7 UBL1-2 domains with an N-terminal Myc tag.DepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_535-1102 USP7…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_775-1102 USP7
Plasmid#131250PurposeMammalian expression of the USP7 UBL3-5 domains with an N-terminal Myc tagDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationEncodes USP7 UBL domains 3-5 (USP7 amino acids 77…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-N-Myc_1-1083 USP7
Plasmid#131251PurposeMammalian expression of N-terminally Myc-tagged USP7, minus the C-terminal 18 amino acidsDepositorInsertUbiquitin carboxyl-terminal hydrolase 7 (USP7 Human)
TagsMycExpressionMammalianMutationA mutant form of our pcDNA3.1-N-Myc_WT USP7 plasm…Available SinceDec. 17, 2020AvailabilityAcademic Institutions and Nonprofits only