We narrowed to 171,035 results for: addgene
-
Plasmid#222606PurposeExpression of MAC3-tagged GFP-NES (N-terminal)DepositorInsertEGFP and 3' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-NTRK3
Plasmid#222612PurposeExpression of MAC3-tagged NTRK3DepositorAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-NLS
Plasmid#222607PurposeExpression of MAC3-tagged GFP-NLS (N-terminal)DepositorInsertEGFP and 3' nuclear localizaition sequence (NLS)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-NES
Plasmid#222603PurposeExpression of MAC3-tagged GFP-NES (C-terminal)DepositorInsertEGFP and 5' nuclear exclusion sequence (NES)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-N-GFP-Myr
Plasmid#222608PurposeExpression of MAC3-tagged GFP-Myr (N-terminal)DepositorInsertEGFP and 3' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
MAC3-C-GFP-Myr
Plasmid#222605PurposeExpression of MAC3-tagged GFP-Myr (C-terminal)DepositorInsertEGFP and 5' myristoylation sequence (Myr)
TagsMAC3ExpressionBacterial and MammalianPromoterCMVAvailable SinceAug. 5, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
LEGO-pDHS-AP1x6-GM55
Plasmid#217416PurposeLuciferase expression vector with 6 AP-1 sites and the minimal GM-CSF promoter, and a chromatin priming element. Alias: LEGO-GM55-AP-1x6-pDHS(IL-3)DepositorInsertLuciferase, GFP
UseLentiviral and LuciferaseExpressionMammalianPromoter6 AP-1 sites, Human -55 to +28 minimal CSF2 promo…Available SinceMay 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g2 lentiCRISPRv2-opti
Plasmid#218657PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLEKHA3 (FAPP1) g1 lentiCRISPRv2-opti
Plasmid#218656PurposeKnockout vector for human PLEKHA3 (FAPP1)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g2 LentiCRISPRv2-mCherry
Plasmid#218663PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
GOLIM4 g1 LentiCRISPRv2-mCherry
Plasmid#218662PurposeKnockout vector for human GOLIM4 (GPP130/GOLPH4)DepositorAvailable SinceMay 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CMV-SCLM
Plasmid#216758PurposeAAV2 transfer vector with the CMV promoter for ubiquitous expression of SuperClomeleonDepositorInsertSuperClomeleon followed by WPRE and human growth hormone polyA terminator
UseAAVExpressionMammalianMutationS30R and 11 AA deletion in the Cerulean CFP moiet…PromoterCMV (cytomegalovirus)Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD2 N-terminal sgRNA
Plasmid#207098PurposepX330 based plasmid for expression of Cas9 and the TTTTTATCAGAAATCATGAG sgRNA to target the SHLD2 locus.DepositorInsertTTTTTATCAGAAATCATGAG
ExpressionMammalianPromoterCMV and U6Available SinceApril 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
HaloTag KO sgRNA
Plasmid#207102PurposepX330 based plasmid for expression of Cas9 and the GTCGATGTTGGTCCGCGCGA sgRNA to target the HaloTag coding sequence.DepositorInsertGTCGATGTTGGTCCGCGCGA
ExpressionMammalianPromoterCMV and U6Available SinceMarch 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
MDC1 N-terminal sgRNA
Plasmid#207090PurposepX330 based plasmid for expression of Cas9 and the GTATCCTTCCCAGATCATGG sgRNA to target the MDC1 locus.DepositorInsertGTATCCTTCCCAGATCATGG
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #2
Plasmid#207106PurposepX330 based plasmid for expression of Cas9 and the CTGAAGGAACAGACTAATTC sgRNA to target the SHLD3 locus..DepositorInsertCTGAAGGAACAGACTAATTC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
53BP1 KO sgRNA
Plasmid#207104PurposepX330 based plasmid for expression of Cas9 and the AGATTCTCAGCCTGAAAGCC sgRNA to target the 53BP1 coding sequence.DepositorInsertAGATTCTCAGCCTGAAAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMarch 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLIK NPIPB11-FLAG zeo
Plasmid#192331PurposeLentiviral expression vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT NPIPB11-FLAG
Plasmid#192308PurposeGateway entry vector for an inducible NPIPB11-FLAGDepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-NUP37
Plasmid#192299PurposeGateway entry vector for an inducible 3xFLAG-NUP37DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN_TT 3xFLAG-PFN2_variant2
Plasmid#192300PurposeGateway entry vector for an inducible 3xFLAG-PFN2_variant2DepositorAvailable SinceApril 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
CAGGS-AsCpf1-2A-GFP-U6-tdTomato-sgRNA
Plasmid#194724Purposebased on (CAGGS-AsCpf1-2A-GFP-U6-sgRNA-cloning vector, Addgene 159281), with guide RNA that target tdTomatoDepositorInsertAsCpf1
UseCRISPRExpressionMammalianAvailable SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-cb5-pEGFP-C1
Plasmid#177431PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with its membrane binding region (MBR) replaced with Cb5 targeting sequence. Swap made in original Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationBik MBR removed (after position 136) and replaced…PromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
Venus-Bik-AA-pEGFP-C1
Plasmid#177430PurposeTo express Venus fused to the N-terminus of the Bcl-2 family protein, Bik, with 2 sites of phosphorylation mutated to alanine. T33A and S35A mutations made to Addgene #166737.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsVenusExpressionMammalianMutationThreonine 33 and Serine 35 replaced with alaninePromoterCMVAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSCL.004
Plasmid#184969PurposeNegative control, empty integrating inducible casetteDepositorTypeEmpty backboneExpressionYeastAvailable SinceNov. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-C312S
Plasmid#115263PurposeFor in vitro transcription of human NODAL open reading frame (with a mutated Cysteine residue) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
NODAL-T7TS-N72A-N199A
Plasmid#115264PurposeFor in vitro transcription of human NODAL open reading frame (with two mutated N-glycosylation sites) RNADepositorAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET15b/GVcl 1-1066 /*TBM
Plasmid#162781Purposeamplification of Gallus gallus Vcl mutated in Tankyrase Binding Domain IIDepositorArticleAvailable SinceMay 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Nod-BFP2-TSERex
Plasmid#124785PurposeExpresses the proton pump rhodopsin in mammalian cells under CAG promoterDepositorInsertNod-BFP2
ExpressionMammalianPromoterCAGAvailable SinceMay 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6(gDmap1 v1)-PGK-Puro-BFP
Plasmid#117140PurposeExpress gRNA vs Dmap1DepositorInsertgDmap1 v1 (Dmap1 Synthetic)
UseCRISPR and LentiviralMutationDeleted BbsI site within WPRE, modified BFPPromoterhuman U6 promoter, mouse PGK promoterAvailable SinceApril 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMAZ.1.0-gDNA
Plasmid#112455PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor MAZDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTHRB.1.0-gDNA
Plasmid#112429PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor THRBDepositorAvailable SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
p240_LTJ_sgRNAFoxp3K276X
Plasmid#82675PurposesgRNA targeting murine Foxp3 mutant. Co-expresses SpCas9-2A-EGFP.DepositorInsertsgRNA targeting Foxp3 K276X
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 26, 2018AvailabilityAcademic Institutions and Nonprofits only