We narrowed to 2,898 results for: GFP reporter gene
-
Plasmid#218208PurposeZebrafish -2.1prox1a_2 (not mouse conserved) enhancer reporter in the facial lymphatics at 5 dpf. XCA:DsRed2 as a control in the skeletal and cardiac muscle. Shows the high background typical of the ZED vectorDepositorInsert-2.1prox1a_2
UseZebrafish expressionAvailable SinceAug. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-PRKCZ-C1 (N-PRKCZ-C1)
Plasmid#217760PurposeFluorescent reporter for ceramide (putative, mammalian expression)DepositorInsertProtein kinase C zeta (PRKCZ Human)
TagsEGFPExpressionMammalianMutationC1 domain (aa 123-193)PromoterCMVAvailable SinceJune 11, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
p2705-AGER-eGFP
Plasmid#216474Purposedonor vector for targeting an eGFP reporter to the human AGER locus at the endogenous ATG start siteDepositorInserteGFP
UseCRISPRAvailable SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJFRC201-10XUAS-FRT>STOP>FRT-myr::smGFP-HA
Plasmid#63166PurposeGAL4-responsive UAS "flp-On" spaghetti monster GFP-HA reporterDepositorInsert"spaghetti monster GFP-HA"
TagsN-myristoylationExpressionInsectAvailable SinceMay 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJFRC206-10XUAS-FRT>STOP>FRT-myr::smGFP-V5
Plasmid#63168PurposeGAL4-responsive UAS “flp-On” spaghetti monster GFP-V5 reporterDepositorInsert"spaghetti monster GFP-V5"
TagsN-myristoylationExpressionInsectPromoterGAL4-responsive UAS hsp70Available SinceJune 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEaaK-NanR-J23113-pNanA-CadC-pCadBA-GFP
Plasmid#200277PurposeCharacterisation of the sialic acid-responsive circuit with fluorescent reporterDepositorInsertsCadC
NanR
ExpressionBacterialAvailable SinceAug. 1, 2023AvailabilityAcademic Institutions and Nonprofits only -
C239-E02: attB2r-IRES-ffLuc2-eGFP-pA-attB3
Plasmid#162918PurposeGateway attB2r/attB3 entry clone for generation of polycistronic ffLuc2-eGFP reporter using an internal ribosome entry sequence (IRES)DepositorInsertfirefly luciferase/green fluorescent protein fusion with upstream IRES sequence
UseSynthetic BiologyAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mCamk2a-EGFP
Plasmid#153197PurposeMouse Camk2a (mCamk2a) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJuly 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-CAG-EGFP
Plasmid#153186PurposeCAG promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-hIsl2-EGFP
Plasmid#153206PurposeHuman Isl2 (hIsl2) promoter-mediates gene expression in retinal neurons with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSSA-eGFP (pXK-221)
Plasmid#208826PurposeThe SSA-based surrogate reporter for validating the activity of gene editing tools as well as for helping to screen gene-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(SSA).DepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286D)
Plasmid#127391PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286D)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to Aspartic acidPromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mEGFP-CaMKIIa (T286A)
Plasmid#127390PurposeFluorescent reporter for mutant Ca2+/calmodulin-dependent protein kinase II alpha (T286A)DepositorInsertcalcium/calmodulin-dependent protein kinase II alpha (Camk2a Rat)
TagsmEGFPExpressionMammalianMutationchanged Threonine 286 to AlaninePromoterpCAGAvailable SinceJan. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPLN-hFluc-WT-HA-GFP11-KDEL
Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTol2CG2-QUASM1:GFPNLS-SV40pA
Plasmid#155123PurposeTol2 vector containing QUASM1 reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUASM1:GFPNLS
UseZebrafish expressionPromoterQUASM1-E1bAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of …PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHDR-eGFP (pXK-1647)
Plasmid#208824PurposeThe HDR-based surrogate reporter for validating HDR-editing activity of different gene editing tools as well as for helping to screen HDR-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(HDRDepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB-Neo-COVGT1-d2EGFP
Plasmid#201447PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only