We narrowed to 2,868 results for: GFP reporter gene
- 
  Plasmid#177722PurposeFirefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFluc
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pTol2CG2-QUASM1:GFPNLS-SV40pA
Plasmid#155123PurposeTol2 vector containing QUASM1 reporter element upstream of GFP-NLS. Includes cmlc2:mRFP-SV40pA transgenesis markerDepositorInsertQUASM1:GFPNLS
UseZebrafish expressionPromoterQUASM1-E1bAvailable SinceSept. 15, 2020AvailabilityAcademic Institutions and Nonprofits only - 
  
pEGFP-C1-M3(T3D)471-721
Plasmid#56657PurposeGFP reporter for cytoplasmic inclusions formed by the fused, C-terminal region of protein muNS from mammalian orthoreovirus Type 3 DearingDepositorInsertM3(T3D)421-721
TagsEGFPExpressionMammalianMutationinsert encodes aa 471-721 + native stop codon of …PromoterCMV-IEAvailable SinceJune 20, 2014AvailabilityAcademic Institutions and Nonprofits only - 
  
pBeast-pAhpC-RBS- sfGFP
Plasmid#190051PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pAhpC promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pHDR-eGFP (pXK-1647)
Plasmid#208824PurposeThe HDR-based surrogate reporter for validating HDR-editing activity of different gene editing tools as well as for helping to screen HDR-editing positive cells. Key Construct: CAG-PuroR-CMV-eGFP*(HDRDepositorTypeEmpty backboneExpressionMammalianPromoterCMVAvailable SinceDec. 14, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only - 
  
pPB-Neo-COVGT1-d2EGFP
Plasmid#201447PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT1_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pPB-Neo-COVGT2-d2EGFP
Plasmid#201448PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT2_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pPB-Neo-COVGT4-d2EGFP
Plasmid#201449PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT4_d2EGFP
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pPB-NeoCOVGT3-d2EGFP-mCherry
Plasmid#201450PurposeFluorescent reporter for genetic tracing of epithelial cell SARS-CoV2 response.DepositorInsertCOVGT3_d2EGFP-mCherry
UseSynthetic BiologyAvailable SinceJuly 17, 2023AvailabilityAcademic Institutions and Nonprofits only - 
  
pBeast-pYjjZ-RBS- sfGFP
Plasmid#190054PurposeGFP containing reporter plasmid expressing it under the control of the reportedely OxyR/H2O2 inducible pYjjZ promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pBeast-pKatG-RBS- sfGFP
Plasmid#190053PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pKatG promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pBeast-pOxyS-RBS- sfGFP
Plasmid#190052PurposeGFP containing reporter plasmid expressing it under the control of the OxyR/H2O2 inducible pOxyS promoterDepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceNov. 22, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pPLN-hFluc-DM-HA-GFP11-KDEL
Plasmid#177723PurposeDM Firefly luciferase reporter fused to a prolactin signal sequence for ER targeting and KDEL for ER retention with an HA tag and the eleventh β-strand of GFP added to the C-terminusDepositorInserthFlucDM
TagsGFP11, HA, KDEL, and Prolactin Signal SequenceExpressionBacterial and MammalianMutationR188Q, R261Q (Destabilized Mutant)Available SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
p2T-CAG-MCS-P2A-GFP-PuroR
Plasmid#107186PurposeBase plasmid for cloning gene duplication alleles with eGFP reporter.DepositorTypeEmpty backboneAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only - 
  
PCR4-Hsp68::mCherry-SI-Hsp68::eGFP-H11
Plasmid#211942Purposedual-enSERT-2.2 vector for site-specific integration of.a two-color enhancer-reporter construct into the H11 locus (separated by a synthetic insulator)DepositorTypeEmpty backboneUseCRISPR and Mouse TargetingExpressionMammalianPromoterHSP68Available SinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only - 
  
pAAV-EF1a-DIO-H2B.APEX-P2A-EGFP
Plasmid#182825PurposeCre-dependent expression of H2B-APEX fusionDepositorInsertH2B.APEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pAAV-EF1a-DIO-APEX.NES-P2A-EGFP
Plasmid#182824PurposeCre-dependent expression of cytosolic APEXDepositorInsertAPEX.NES-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pAAV-EF1a-DIO-LckAPEX-P2A-EGFP
Plasmid#182826PurposeCre-dependent expression of membrane localized APEXDepositorInsertLckAPEX-P2A-EGFP
UseAAVTagsEGFP reporter (P2A)PromoterEF1aAvailable SinceMay 16, 2022AvailabilityAcademic Institutions and Nonprofits only - 
  
pCAGGS-Akt-FoxO3a-KTR-EGFP
Plasmid#125131PurposeFluorescent reporter for Akt activityDepositorInsertFOXO2 (FOXO3 Human)
TagsEnhanced green fluorescent protein (EGFP)ExpressionMammalianMutationFoxO3A 1-402 amino acidPromoterCAG promoterAvailable SinceJune 28, 2019AvailabilityAcademic Institutions and Nonprofits only