We narrowed to 1,415 results for: TOX
-
Plasmid#87381PurposeRetroviral transfection of cells to express ratiometric Pericam as described by Nagai et al 2001 (PMID 11248055) localising to the mitochondrial matrix via the transit peptide from human COX8A.DepositorInsertMito-Pericam [ratiometric]
UseRetroviralExpressionMammalianPromoterRetroviral 5' LTR promoterAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD
Plasmid#25049DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
AAV-CMV-Vcan-V3-HA
Plasmid#238076PurposeExpresses Vcan V3 in mice heart tissuesDepositorAvailable SinceAug. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-PA50
Plasmid#84906Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceApril 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSN840
Plasmid#184832PurposeExpresses human KIF5A(∆exon27) and human KLC1 in insect cellsDepositorUseCre/LoxTagsHis-FLAG and mScarlet-2xStrepIIExpressionInsectMutation∆exon27 form of human KIF5APromoterp10 and polyhedrinAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GA50
Plasmid#84907Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG303-Gal-GR100
Plasmid#84908Purposeinduce expression of dipeptide repeat GR in yeastDepositorAvailable SinceNov. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PR50
Plasmid#84901Purposeinduce expression of dipeptide repeat PR in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-PA50
Plasmid#84902Purposeinduce expression of dipeptide repeat PA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416-Gal-GA50
Plasmid#84903Purposeinduce expression of dipeptide repeat GA in yeastDepositorAvailable SinceNov. 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
hSyn-HA-PGRN-LAMP1TM-IRES-GFP
Plasmid#234877PurposeLentiviral plasmid expressing HA-tagged human progranulin that is fused to the transmembrane domain and cytosolic tail of LAMP-1. Enables lysosomal delivery of progranulin without secretion.DepositorInsertProgranulin (GRN Human)
UseLentiviralTagsHA tag and LAMP-1 transmembrane domain and cytoso…ExpressionMammalianPromoterhSYnAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {mCAR}off-{DTR-GFP}on-WPRE
Plasmid#111395PurposeAAV vector with hSynapsin promoter, Cre-OFF mCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(milli)-BoNT/B(147-441, Y365A)
Plasmid#122985PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(milli)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(milli)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains A58V,R73Q "milli" mutatio…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pBABE-α-Syn-nYFP
Plasmid#92203PurposeRetroviral overexpression vector for α-Syn bimolecular fluorescence complementation (BiFC)DepositorAvailable SinceAug. 7, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO {hCAR}off-{DTR-GFP}on-W3SL
Plasmid#111396PurposeAAV vector with hSynapsin promoter, Cre-OFF hCAR (for efficient CAV-2 infection), Cre-ON DTR-EGFP (diphtheria toxin receptor for cell ablation), and W3SL cassette (for maximize cloning capacity)DepositorInsertsUseAAVTagsEGFP and MycExpressionMammalianPromoterhSynapsinAvailable SinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn mCh-IRES-SspB(micro)-BoNT/B(147-441, Y365A)
Plasmid#122986PurposeAAV plasmid with human synapsin promoter driving mCh and SspB(micro)-BoNT/B amino acids 147-441 separated with an IRES element. Co-express with BoNT/B(1-146)-iLID construct for PA-BoNTDepositorInsertmCh-IRES-SspB(micro)-BoNT/B(147-441)
UseAAVTagsmChExpressionMammalianMutationSspB contains R73Q "micro" mutation, Bo…Promoterhuman synapsinAvailable SinceMarch 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-HSD17B11
Plasmid#161923PurposeTo generate HSD17B11 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against HSD17B11 exon 1.DepositorInsertsgRNA targeting HSD17B11 exon 1
UseCRISPRPromoterU6Available SinceMay 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-R1441C
Plasmid#25050DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 17, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDEST53-LRRK2-3XKD-Y1699C
Plasmid#25051DepositorInsertLRRK2 (LRRK2 Human)
TagsGFPExpressionMammalianMutation"Kinase Dead" Lysine 1906 mutated to A…Available SinceJune 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only