We narrowed to 1,627 results for: sgrna vector
-
Plasmid#231364PurposePle155-driven mRuby2, containing cassette for BbsI-based Golden Gate assembly (e.g. of sgRNA cassette(s)). Can be used as 'no guide' control.DepositorInsertmRuby2
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.minBG-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231365PurposeminBG-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Ple155-CI-EGFP-W3SL_2x-U6-sasgAi14
Plasmid#231366PurposePle155-driven EGFP, also encoding U6-driven sgRNAs to direct saCas9 to both sides of stop cassette in Ai14 mice.DepositorInsertEGFP
UseAAVAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT22
Plasmid#223394PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpRYD10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceMay 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT39
Plasmid#223411PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants select.DepositorInsert2x35s-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT19
Plasmid#223391PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT27
Plasmid#223399PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for dicot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 was driven by 2x35s and the sgRNA was driven by AtU3; Kanamycin for plant select.DepositorInsert2x35s-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-AtU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT13
Plasmid#223385PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter.DepositorInsertAtUBQ10-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv4
Plasmid#221432PurposeLentiviral CRISPR/Cas9 vector for co-expression of sgRNAs and Cas9 protein.DepositorTypeEmpty backboneUseCRISPR and LentiviralAvailable SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO_Ollas.S.V5_mCherry-NLS
Plasmid#178211PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsNuclear Localization Signal and Ollas.S.V5PromotereF1aAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.HSV.S_mCherry-NLS
Plasmid#178224PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.HSV.S and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO_AU1.C.VSVg_mCherry-NLS
Plasmid#178214PurposeNuclear Protein Barcode (nPC) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables spatial detection of CRISPR screens.DepositorInsertnPC Tagged mCherry-NLS
UseLentiviralTagsAU1.C.VSVg and Nuclear Localization SignalPromotereF1aAvailable SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgRB1#1
Plasmid#174144PurposeLentiviral vector expressing a sgRNA against the human RB1 geneDepositorAvailable SinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.NWS.VSVg_NGFR
Plasmid#158243PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.NWS.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.V5.VSVg_NGFR
Plasmid#158244PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.V5.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HA.FLAG.VSVg_NGFR
Plasmid#158245PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsHA.FLAG.VSVgMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-UN-Cas9
Plasmid#135011PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9DepositorInserthumanized S. pyogenes Cas9
Tags126aa domain from HSV-1 UL12 fused to the N-termi…ExpressionMammalianMutation126aa domain from HSV-1 UL12 fused to the N-termi…PromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT09
Plasmid#223381PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only