We narrowed to 15,279 results for: grn
-
Plasmid#207361PurposeExpression plasmid for human codon-optimized increased-fidelity (i.e. high-fidelity) SpCas9 variantDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertB-Sniper SpCas9
UseCRISPRTags3xFLAGExpressionMammalianMutationF539S, M763I, K890N, amino acids 1005-1013 replac…PromoterCBhAvailable sinceOct. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLC-Flag-SENP8 sg2R-P2A-Hygro
Plasmid#124300PurposeLentiviral vector for expression of Flag tagged SENP8-P2A-Hygro casette from a CMV promoter. SENP8 cDNA contains silent mutations to disrupt a sgRNA binding site.DepositorInsertSENP8 (SENP8 Human)
UseLentiviralTagsFlagExpressionMammalianMutationseveral silent mutations to disrupt sgRNA targeti…PromoterCMVAvailable sinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNR2F1.1.0-gDNA
Plasmid#112484PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor NR2F1DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertNR2F1 (NR2F1 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCUX1.1.0-gDNA
Plasmid#112434PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CUX1DepositorAvailable sinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable sinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQ141-ZmUBI-RZ-Cas12j2
Plasmid#189781PurposeCas12j2 (CasΦ) Gateway gRNA entry plasmid using Zea mays Ubi promoter and HH, HDV ribozyme processingDepositorInsertgRNA cloning site
UseCRISPRAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLL5.0-Anillin ShRNA-Cherry-Anillin deltaAnillin homology domain
Plasmid#187277PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Anillin homology domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaAnillin homology domainPromoterU6, CMVAvailable sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNT-shRNA1
Plasmid#166910PurposeLentivirus for inducible knockdown of human ARNTDepositorAvailable sinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNT-shRNA2
Plasmid#166911PurposeLentivirus for inducible knockdown of human ARNTDepositorAvailable sinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Tet-On-ARNT-shRNA3
Plasmid#166912PurposeLentivirus for inducible knockdown of human ARNTDepositorAvailable sinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV-NeoR_dCas9-Sniper-KRAB_sgSTK3i_#2 (NeoR)
Plasmid#209775PurposeCRISPRi for STK3DepositorAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-AlbEx14-mNG
Plasmid#201780Purposeknocks in mNeonGreen into exon 14 of Alb to produce Alb-mNeonGreen fusion protein in miceDepositorAvailable sinceJuly 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
BPK1520-LRRK2-G2019S-ng
Plasmid#180436PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of LRRK2-G2019S mutation in PE3 approachDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertncRNA targeting LRRK2-G2019S (LRRK2 Human)
UseCRISPRExpressionMammalianPromoterU6Available sinceNov. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-HDC-DIO-GFP-shRNA.scramble
Plasmid#184331PurposeExpresses scramble shRNA for control expts. Flexed (DIO) cassette driven by hdc promoter fragment for pan neuronal expressionDepositorInserthdc pan neuronal gene promoter, flex switch, GFP, scramble shRNA
UseAAV, Cre/Lox, Mouse Targeting, and RNAiExpressionMammalianPromoterhistidine decarboxylase promoter fragment that g…Available sinceJune 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pInducer20_SLC38A2_N82A
Plasmid#156183PurposeDox-inducible expression of sgRNA-resistant SLC38A2 N82A mutant cDNA.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSLC38A2 (SLC38A2 Human)
ExpressionMammalianMutationSilent mutations to prevent targeting by sgRNA: T…PromoterTREAvailable sinceAug. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR EGFP-guide3
Plasmid#118164PurposeCRISPRi negative control. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter, and sgRNA3 against the EGFP CDSDepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR GLIS3 TSS-guide3
Plasmid#118175PurposeCRISPR-mediated repression of GLIS3. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR TCF7L2 TSS-guide3
Plasmid#118171PurposeCRISPR-mediated repression of TCF7L2. KRAB domain and catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available sinceApril 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pET-pro-siRNA-V2-LMNA
Plasmid#111088PurposepET-pro-siRNA-V2 based plasmid for production of recombinant siRNAs (pro-siRNAs) against human Lamin A/C gene.DepositorInsertLamin A/C (LMNA Human)
ExpressionBacterialAvailable sinceMarch 1, 2019AvailabilityAcademic Institutions and Nonprofits only