We narrowed to 13,759 results for: lic
-
Plasmid#78215Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS1katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78217Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pZS2katGp-RBS31-PhiC31-proD-oxyR
Plasmid#78213PurposeSynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
CSNK1G2
Plasmid#39150PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable SinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
Bxbi+PhiC31 GFP Bandpass BAC Reporter
Plasmid#78218Purposesynthetic gene circuitDepositorInsertsynthetic circuit
Available SinceMay 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F7
Plasmid#234973PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F7
ExpressionBacterialAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F8
Plasmid#234974PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F8
ExpressionBacterialAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBAC-T7-F6
Plasmid#234972PurposeA segment of the T7 phage genome was inserted into the artificial bacterial chromosome . The genome segment can be stably replicated in plasmid and can be genetically modified at the plasmid levelDepositorInsertT7-F6
ExpressionBacterialAvailable SinceJuly 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLSL.R.Ly
Plasmid#227697PurposeReengineered geminiviral replicon vectorDepositorTypeEmpty backboneExpressionPlantAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEF-GalNAcT2-moxGFP2
Plasmid#218966PurposeExpresses full length GalNAcT2-moxGFP2 mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG HRP-TM
Plasmid#44441DepositorArticleInsertHorseradish peroxidase fused to the transmembrane domain of PDGFR
TagsHA tag and myc tagExpressionMammalianPromoterCAGAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only -
HA-Halotag-FRB-EX-nes_pLX304
Plasmid#120913PurposeLentiviral vector expressing HA-Halotag-FRB-EX-NES in mammalian cytosolDepositorInsertHA-Halotag-FRB-EX-NES
UseLentiviralExpressionMammalianAvailable SinceMarch 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDest eGFP MBNL1 42 kDa
Plasmid#61277PurposeMammalian expression of EGFP-tagged human MBNL1DepositorAvailable SinceDec. 11, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-BirA-ER
Plasmid#20856DepositorInsertBirA-ER
ExpressionMammalianMutationC-terminal ER targeting sequence (KDEL)Available SinceMay 7, 2009AvailabilityAcademic Institutions and Nonprofits only -
pSR1037
Plasmid#208736PurposeCharacterization plasmid for PSarA1 (sfgfp expressed from PSarA1 on the S. aureus pC194 replicon)DepositorInsertPSarA1
UseSynthetic BiologyExpressionBacterialAvailable SinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEF-GalNAcT2-msGFP2
Plasmid#218965PurposeExpresses full length GalNAcT2-msGFP2 mammalian cellsDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-Casp8
Plasmid#11817DepositorInsertCaspase 8 (CASP8 Human)
ExpressionMammalianAvailable SinceMay 25, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSETA_crGE
Plasmid#172927PurposeCrowding FRET sensor with mCerulean3 and mCitrine for E. coli expression. Linker comprises 2 helices and 3 GSG domains.DepositorInsertCrowdingSensorGE
TagsHisExpressionBacterialPromoterT7Available SinceAug. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLG320
Plasmid#124370PurposeVanillic acid inducible system for expression in B. subtilisDepositorInsertgfpmut2
ExpressionBacterialPromoterPspank(V)Available SinceJan. 24, 2026AvailabilityAcademic Institutions and Nonprofits only