We narrowed to 51,397 results for: des.1
-
Plasmid#248296PurposeAn expression construct encoding a CIBN-fused STIM1 fragment (a.a.238-685).DepositorInsertCIBN-fused STIM1 fragment (a.a.238-685) (STIM1 Human)
TagsCIBNExpressionMammalianMutationdeleted amino acids 1-237PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pCMV-EGFP-CRY2-STIM1(318-450)
Plasmid#248294PurposeAn expression construct encoding a CRY2-fused truncated STIM1 fragment (a.a.318–450).DepositorInsertCRY2-fused truncated STIM1 fragment (a.a.318–450) (STIM1 )
TagsEGFPMutationdeleted amino acids 1-317,451-685PromoterCMVAvailable SinceJan. 14, 2026AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Flag-SOD1-G86R
Plasmid#235663PurposeExpress human SOD1-G86R in mammalian cellsDepositorInsertSOD1-G86R (SOD1 Human)
TagsFlag-tag at N-terminalExpressionMammalianMutationchanged Glycine 86 to argininePromoterCMV promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-Flag-SOD1-D91A
Plasmid#235664PurposeExpress human SOD1-D90A in mammalian cellsDepositorInsertSOD1-D91A (SOD1 Human)
TagsFlag-tag at N-terminalExpressionMammalianMutationchanged Aspartic acid 91 to alaninePromoterCMV promoterAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-13X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234370PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-13XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT1-24X-gRNA1-2(AtUBI10)-MTAP-LUC
Plasmid#234372PurposeT-DNA vector for expression of the two protein components of the MoonTag system under the control of the Arabidopsis Ubi10 promoter; Luciferase under control of transactivated promoter by two gRNAsDepositorInsertsNbGP41-sfGFP-VP64-GB1
Luciferase
dCas9-24XGP41
gRNA 1-1 and gRNA 1-2
UseSynthetic BiologyTagsGB1, GP41, and sfGFPExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and MTAP1 (syn…Available SinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCHMP3-mut-NS3-Green
Plasmid#223530PurposeMammalian expression of CHMP3 fused to the hepatitis C virus protease NS3 through a short linker containing mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP3 (CHMP3 Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCHMP2A-mut-NS3-Green
Plasmid#223529PurposeMammalian expression of CHMP2A fused to the hepatitis C virus protease NS3 through a short linker containing a mutated NS3 cleavage site, along with a green fluorescent protein.DepositorInsertCHMP2A (CHMP2A Human)
TagsNS3 Hepatitis C protease and mNeonGreenExpressionMammalianPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
EF1a-hP53DD (TET+CTD)
Plasmid#214082PurposeMammalian expression tetramerization domain (TET) and C-terminal negative regulatory domain (CTD) of human TP53DepositorAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKM 1995
Plasmid#217826PurposeExpresses 1554 bp fragment of HY4 gene in A. thaliana. This HY4 fragment shows high homology to the phr genes in prokaryotes.DepositorAvailable SinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
Creb5 shRNA
Plasmid#195020PurposeBovine Creb5 shRNA targeting the Creb5 3′UTRDepositorInsertCreb5 shRNA (CREB5 Bovine)
ExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIFEX-A2aGH
Plasmid#160542PurposepITY4 derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEFEX1-A2aGH
Plasmid#160543PurposepYES2 derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCFEX1-A2aGH
Plasmid#160546PurposepYC2/CT derivative reporter plasmid encoding Ashbya gossypii PTEF1-Saccharomyces cerevisiae FEX1-MFaT; as well as PGAL1-Homo sapiens ADORA2A-EGFP-10HIS-MFaT.DepositorInsertExpressionYeastMutationN/AAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA T7-Gnat1 Mut-3UTR
Plasmid#184027PurposeExpresses mouse Gnat1 protein with N-terminal T7 tag from cDNA that contains the mutant 3'-UTR where the TAG binding sites for MSI1 are mutated to TGADepositorInsertGnat1 (Gnat1 Mouse)
TagsT7ExpressionMammalianMutationTAG sites in the 3'-UTR are mutated to TGAPromoterCMVAvailable SinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMVS142_pACT1_mCherry_Zif268_EBD_MCS_KAN
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsExpressionYeastAvailable SinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Neo_h53BP1_gRNA_D
Plasmid#110300PurposeExpresssion of Cas9-T2A-neomycin resistant gene and a gRNA targeting exon 10 of human 53BP1DepositorInsertp53-binding protein 1 (TP53BP1 Human)
ExpressionMammalianAvailable SinceFeb. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
CMV-ShadowY-CBD(H83L/H86L)-P2A-Clover(T153M/F223R)-Cdc42
Plasmid#165436PurposeExpresses ShadowY-CBD(H83L/H86L) and Clover(T153M/F223R)-Cdc42 in mammalian cells as a negative control for FLIM imaging.DepositorInsertShadowY-CBD(H83L/H86L)-P2A-Clover(T153M/F223R)-Cdc42
TagsShadowY, Clover(T153M/F223R)ExpressionMammalianMutationH83L/H86L: CDB(Cdc42 Binding Domain, Pak3, residu…PromoterCMVAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
MB 103C ttrSR(m13)-Bxb1_P7-sfGFP_mCherry
Plasmid#232475PurposeOptimized tetrathionate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceNov. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
P2_DD-HNF4A8_C106R
Plasmid#31096DepositorInsertHNF4A (HNF4A Human)
UseFlp/frtTagsFKBP L106P and mycExpressionMammalianMutationsplice variant 8 derived from promoter P2 with zi…Available SinceOct. 14, 2011AvailabilityAcademic Institutions and Nonprofits only