We narrowed to 1,487 results for: aav vector plasmid
-
Plasmid#99694PurposeExpresses dSa Cas9 fused to optimized combination of truncated activation domains from SCP1 promoter with dual snRP1 poly adenylation signal, and Sa sgRNA for Actc1, vector allows for strong activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA: GGTATATAAGGGGTTTTAAG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVPR miniMutationdead Cas9Available SinceJan. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pOTTC292 - pAAV EF1a floxed hChR2(H134R)-EYFP
Plasmid#50834PurposeAn AAV packaging vector that expresses channel rhodopsin 2 (H134R) (fused to EYFP) under the EF1a promoter, which can be deactivated (deleted) by recombination between the flanking loxP sites.DepositorInserthChR2 (H134R)
UseAAV and Cre/LoxTagsEYFPExpressionMammalianMutationH134RPromoterEF1aAvailable SinceOct. 9, 2014AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1664 - pAAV SYN1 mGas6(delta)-Myc-DDK
Plasmid#202541PurposeAn adeno-associated viral vector expressing murine Gas6 with deletion of (F50-E275) fused Myc and DDK epitopes from a synapsin promoterDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI3sub-Kv-WPRE
Plasmid#246618PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3sub in AAV production vector for neuron -specific expression using the promoter hSynDepositorInsertJEDI3sub-Kv
UseAAVTagsKvExpressionMammalianPromoterhSynAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI3hyp-WPRE
Plasmid#246637PurposeGenetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI3hyp
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI3hyp-Kv-WPRE
Plasmid#246638PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI3hyp-Kv
UseAAVTagsKvExpressionBacterialPromoterCaMKIIaAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI3sub-WPRE
Plasmid#246624PurposeGenetically encoded voltage indicator (GEVI) JEDI3sub in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI3sub
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-JEDI3sub-Kv-WPRE
Plasmid#246625PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3sub in AAV production vector for expression in excitatory glutamatergic neurons using the promoter CaMKIIaDepositorInsertJEDI3sub-Kv
UseAAVTagsKvExpressionMammalianPromoterCaMKIIaAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-JEDI3hyp-Kv-WPRE
Plasmid#246631PurposeSoma and AIS-localized genetically encoded voltage indicator (GEVI) JEDI3hyp in AAV production vector for neuron -specific expression using the promoter hSynDepositorInsertJEDI3hyp-Kv
UseAAVTagsKvExpressionMammalianPromoterhSynAvailable SinceApril 23, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E22-ChR2GFP2x
Plasmid#153436PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E22 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f
Plasmid#135632PurposeAAV vector to drive the expression of GCaMP6f in PV cortical interneuronsunder the control of the E2 regulatory elementDepositorHas ServiceAAV PHP.eB, AAV1, and AAV9InsertGCaMP6f
UseAAVMutationNoneAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E29-ChR2GFP2x
Plasmid#153437PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E29 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E14-ChR2GFP2x
Plasmid#153435PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E14 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-E11-ChR2GFP2x
Plasmid#153434PurposeAAV vector to drive the expression of dChr2-GFP-P2A-GFP in PV cortical interneuronsunder the control of the E11 regulatory elementDepositorInsertChr2-GFP-P2A-GFP
UseAAVAvailable SinceAug. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn1-SIO-eOPN3-mScarlet-WPRE
Plasmid#125713PurposeCre-dependent vector expressing an optimized mosquito OPN3 rhodopsin in-frame with mScarletDepositorHas ServiceAAV1 and AAV5InserteOPN3
UseAAV and Cre/LoxTagsRho1D4 and mScarletExpressionMammalianMutationdeleted amino acids 331-429PromoterhSyn1Available SinceSept. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(ARID1A(44))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200506PurposeLentiviral vector expressing gRNA targeting human ARID1A and AAVS1DepositorAvailable SinceJan. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2.2-h7SKgRNA5(SMARCA4(43))-hU6gRNA5(AAVS1)-PGKpuroBFP-W
Plasmid#200503PurposeLentiviral vector expressing gRNA targeting human SMARCA4 and AAVS1DepositorAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn1-GRAB-HTR6-cilia
Plasmid#189615PurposeExpresses cilia-targeted serotonin sensor based on HTR6 receptor and cpEGFP, driven by SYN promoterDepositorInsertHTR6_GRAB
UseAAVPromoterSyn1Available SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4s-NGR-WPRE
Plasmid#234453PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLP-FRT-iGluSnFR4f-NGR-WPRE
Plasmid#234454PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and fast deactivation kinetics (4f = fast); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4f-NGR
UseAAV; Flp/frtTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianPromoterSynapsinAvailable SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only