We narrowed to 4,431 results for: chm
-
Plasmid#132396PurposeTargets AAVS1 intron 1, gRNA: ACCCCACAGTGGGGCCACTA, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pBabe mouse Bmf
Plasmid#17241DepositorAvailable SinceJan. 18, 2008AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-RATA
Plasmid#184270PurposeExpresses shRNA resistant GFP-RepoMan RATA MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
Tags3xHA and GFPExpressionMammalianMutationV383A, F395APromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-T394A
Plasmid#204994PurposeExpresses shRNA resistant GFP-RepoMan T394A MutantDepositorInsertcell devision cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Threonine 394 to AlaninPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA s3
Plasmid#132395PurposeTargets AAVS1 intron 1, gRNA: GGGGCCACTAGGGACAGGAT, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
α‐eGFP
Plasmid#160214PurposeRetroviral construct to express an eGFP-tagged version of the α subunit of AP2DepositorUseRetroviralTagseGFP at Hinge regionMutationBrain-specific InsertAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAVS1 intron 1 gRNA as2
Plasmid#132394PurposeTargets AAVS1 intron 1, gRNA: AGAACCAGAGCCACATTAAC, MLM3636 backboneDepositorAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-Bhlhe40-3xFLAG-IRES-BFP
Plasmid#117263PurposeRetroviral overexpression of Bhlhe40 with a 3xFLAGDepositorAvailable SinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-camk2-Sthk-p2a-bpac(WT) minWPRE
Plasmid#118274PurposeExpresses the SthK channel & bPAC(WT)-mCherry under a minimal CamKII promoterDepositorInsertsbPAC(WT)
SthK
UseAAVTagsHis tag, P2A, mCherry, and myc tagExpressionMammalianPromoterCamK IIAvailable SinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-FLEX-synaptoPAC-minWPRE
Plasmid#153100PurposeCre-conditional expression of synaptoPAC, a fusion of synaptophysin, mScarlet, and bPAC in neuronsDepositorInsertsUseAAVTagsHis tag, mScarlet, and myc tagExpressionMammalianAvailable SinceAug. 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS DV DNM2-mRUBY2
Plasmid#107793Purposedonor vector for knock-in gene editing at human DNM2 locusDepositorInsertDNM2-mRuby2 (DNM2 Human, Synthetic)
UseYeast-e.coli shuttle vectorExpressionBacterial and YeastAvailable SinceMay 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-Cyclin B1 ND
Plasmid#234706Purposeallows tethering of non degradable (ND) cyclin B1 protein to lacO repeats in specific chromatin lociDepositorAvailable SinceApril 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-BUBR1
Plasmid#234704Purposeexpression of fusion proteinDepositorAvailable SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
H2B-GFP-Aurora B KD
Plasmid#184043PurposeExpresses H2B-GFP fused to Aurora B kinase deadDepositorInsertAURKB (AURKB Human)
TagsEGFP and H2BExpressionMammalianMutationChanged Lysine 65 to ArgininePromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Repo-Man-1-890
Plasmid#184272PurposeExpresses C-terminally truncated GFP-RepoManDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationtruncated Repo-Man after aminoacid 893PromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-RepoMan-S893D
Plasmid#204995PurposeExpresses shRNA resistant GFP-RepoMan S893D MutantDepositorInsertcell division cycle associated 2 (CDCA2 Human)
TagsGFPExpressionMammalianMutationchanged Serine 893 to Aspartic acidPromoterCMVAvailable SinceJune 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
His-MBP-IST1 N-terminal domain
Plasmid#184805PurposeBacterial expression of IST1 N-terminal domainDepositorAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
lenti.DTR.GFP
Plasmid#201962PurposeLentiviral vector that expresses diptheria toxin receptor (DTR) C-terminally fused to EGFPDepositorInsertDiptheria Toxin Receptor
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1alphaAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-GFP-dynein-2(D1091–Q4307)
Plasmid#64064PurposeCodon-optimized human dynein-2 motor domain (D1091–Q4307) for baculovirus expression. 6His-ZZ-GFP N-terminal tag, TEV site to cleave 6His-ZZ.DepositorInsertCytoplasmic dynein-2 (DYNC2H1 Human)
TagsGFP, His tag, and ZZ tagExpressionInsectMutationDeleted amino acids 1-1090, extra C-terminal vali…PromoterPolyhedrinAvailable SinceApril 29, 2015AvailabilityAcademic Institutions and Nonprofits only -
MLM3636-Prnp-CDS-Pos
Plasmid#61857PurposeExpresses a gRNA plasmid targeting the prion gene's exon 3, positive strandDepositorAvailable SinceFeb. 3, 2015AvailabilityAcademic Institutions and Nonprofits only