We narrowed to 14,475 results for: cas9 genes
-
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-35S
Plasmid#226706PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from CaMV 35S promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrActin-UBI
Plasmid#226709PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrActin promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrActin
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRGEB32-CrU6-2-UBI
Plasmid#226707PurposeFor CRISPR/Cas-mediated gene editing in model fern species, Ceratopteris richardii; expresses guide RNAs from CrU6-2 promoter and Cas9 from maize ubiquitin (ZmUbi) promoter.DepositorInsertCrU6-2
UseCRISPRAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR_DKO
Plasmid#183192PurposePlasmid with Cas9, two U6 promoters and two gRNA scaffolds that allows for inserting two gRNAs for combinatorial CRISPR Screen or double-knock-out (DKO) screenDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterhU6, mU6Available SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pY094
Plasmid#84743PurposeExpresses huAsCpf1-T2A-GFP and crRNA guideDepositorInsertshuAsCpf1
GFP
Tags3xHA, NLS, and T2AExpressionMammalianPromoterCMVAvailable SinceJan. 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiSAM v2 (Puro)
Plasmid#92062PurposeModified version of lentiSAM v2, a lenti sgRNA cloning backbone with MS2 loops at tetraloop/stemloop 2, dCas9-VP64, and puro resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 (sgRNA) and EF1a (dCas9-VP64)Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
lentiBE3-SpRY-Blast
Plasmid#199303PurposeExpresses SpRY Cas9 nickase cytosine base editor FNLS-BE3 and blasticidin resistanceDepositorInsertFNLS-BE3-SpRY
UseCRISPR and LentiviralTags2A tagExpressionMammalianPromoterEFSAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-mcherry
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-SCN8A-SVA-BFP
Plasmid#202826PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the SCN8A gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within SCN8A gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-AK057321-SVA-mcherry
Plasmid#202821PurposeLentiviral vector modified to express two sgRNAs that delete the SVA within the SVA-lncRNA AK057321 gene (exon 3) with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within SVA-lncRNA AK057321 gene
UseLentiviralExpressionMammalianPromoterU6 (two)Available SinceJuly 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CHAF1B-SVA-BFP
Plasmid#202825PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CHAF1B gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete intronic SVA within CHAF1B gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330 Ctnnb1.2
Plasmid#59912PurposepX330 backbone expressing sgRNA targeting Ctnnb1 to edit mouse beta-Catenin. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgGLS_2
Plasmid#163459Purposelentiviral vector expressing Cas9 and an sgRNA targeting GLSDepositorAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only