We narrowed to 15,506 results for: LIS
-
Plasmid#186082PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTR-456 tNGFR-P2A-ITGB1
Plasmid#186083PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-337 pUC19-tNGFR-P2A-CTLA4 N
Plasmid#186054PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-342 pUC19-tNGFR-P2A-CD28 N
Plasmid#186056PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-449 tNGFR-P2A-CCR2
Plasmid#186057PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTR-473 FOXP1-tNGFR
Plasmid#186063PurposeKnockin of truncated NGFR to target geneDepositorAvailable SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pNL-CEF-IgG1
Plasmid#187010PurposeExpression of human anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1DepositorInsertHuman anti-SARS-CoV-2 S Protein Wuhan-Hu1 IgG1
UseLentiviralAvailable SinceJuly 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-G60A)
Plasmid#176144PurposeEGFP fused to the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Gly60Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Gly60 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-EGFP-PolB-T2A-Myc-SIRT6(PAMmut-R65A)
Plasmid#176143PurposeEGFP fused the N-terminus of POLB, linked by T2A to N-terminus Myc-tagged SIRT6 with the mutation Arg65Ala, a mutation in the PAM site used by SIRT6-KO gRNA1 & a hygromycin resistance cassetteDepositorInsertPolB-T2A-SIRT6 (POLB Human)
UseLentiviralTagsEGFPExpressionMammalianMutationMutation in Arg65 to Ala, and a mutation in the P…PromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(D256A/PAMmut)
Plasmid#176141PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutation Asp256Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutation in Asp256 to Ala, a…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(K35A/K68A/K72/PAMmut)
Plasmid#176140PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with the mutations Lys35Ala, Lys68Ala, Lys72Ala, a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resisDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianMutationMyc-tagged PolB with mutations Lys35 to Ala, Lys6…PromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1a-XRCC1-EGFP-T2A-Myc-POLB(PAMmut)
Plasmid#176139PurposeEGFP fused to the C-terminus of XRCC1, linked by T2A to N-terminus Myc-tagged POLB with a mutation in the PAM site used by POLBKO gRNA1 & a hygromycin resistance cassetteDepositorUseLentiviralTagsEGFP and MYCExpressionMammalianPromoterEF1AAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-POLBHR-eGFP
Plasmid#176064PurposeHomology region +/- 800bp to the transcription start site of POLB, with EGFP inserted in-frame on the N-terminus of POLB, and a mutation in the PAM site used by POLBKO gRNA1 in POLB exon1DepositorInsertEGFP-PolB (POLB Human)
TagsEGFPExpressionMammalianMutationpUC with endogenous SapI mutated out, PAM mutatio…PromoterN/AAvailable SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX030
Plasmid#167154PurposeMoClo-compatible Level 1 (position 5) vector encoding Neonothopanus nambi caffeoylpiruvate hydrolase nnCPH under control of 0.4 kb 35S promoter, for expression in plantsDepositorInsertp35s-nnCPH-ocsT
ExpressionPlantPromoterp35sAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX022
Plasmid#167148PurposeMoClo-compatible Level 0-CDS2 promoterless vector encoding C-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertC-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX021
Plasmid#167147PurposeMoClo-compatible Level 0-SP promoterless vector encoding N-terminal half of the Neonothopanus nambi hispidin synthase nnHispS codon-optimised for expression in Nicotiana benthamianaDepositorInsertN-part of fungal hispidin synthase, nnHispS
UseSynthetic BiologyAvailable SinceJune 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGMC00008
Plasmid#166724PurposesgRNA cloning backboneDepositorTypeEmpty backboneUseCRISPRExpressionMammalianAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucA
Plasmid#174047PurposeExpresses mALG8 (ITYTWTRL) antigen as a fusion to luciferase and Cre recombinaseDepositorInsertLucA
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationALG8 alanine 506 to threoninePromoterHuman Ubiquitin CAvailabilityAcademic Institutions and Nonprofits only -
Lenti-LucL
Plasmid#174048PurposeExpresses mLAMA4 (VGFNFRTL) antigen as a fusion to luciferase and Cre recombinaseDepositorInsertLucL
UseCre/Lox, Lentiviral, and LuciferaseTagsLuciferaseExpressionMammalianMutationLAMA4 glycine 1254 to valinePromoterHuman Ubiquitin CAvailabilityAcademic Institutions and Nonprofits only