We narrowed to 60,703 results for: promoter
-
Plasmid#47657PurposePesaR-D promoter, luxCDABE, and terminator in pET17b (AmpR)DepositorInsertPesaR-D
UseSynthetic BiologyExpressionBacterialMutationAdded an additional esa box upstream of -35 site …PromoterPesaR-DAvailable SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMCMV3
Plasmid#85711PurposeExpression vector employing the mouse CMV major immediate-early promoter enhancer (MIEP); there is a small polylinker (PstI, SmaI, XbaI, SalI ,HpaI) followed by the SV40 polyA signal sequencesDepositorTypeEmpty backboneExpressionMammalianPromoterMIEPmouse CMV MIEPAvailable SinceApril 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
lvl0 G7t
Plasmid#153380PurposeAgrobacterium terminator for plant expressionDepositorInsertG7 terminator
ExpressionPlantAvailable SinceOct. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPROBE-TT'
Plasmid#37823DepositorInsertPromotorless gfp reporter gene
Available SinceJuly 23, 2012AvailabilityAcademic Institutions and Nonprofits only -
pMAP L1A
Plasmid#153343PurposeMobius Assembly cloning and expression vector for plants with high-copy number origin of replicationDepositorTypeEmpty backboneExpressionPlantAvailable SinceNov. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pBAT4
Plasmid#112580PurposeUsed for expression of protein in E. coli as non-fusionsDepositorTypeEmpty backboneExpressionBacterialAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pWN_U6-TRAC-miniGag
Plasmid#228960PurposeminiEDV production plasmid. Expresses the miniGag polypeptide (CAG promoter) and sgRNA (human U6 promoter)DepositorInsertminiGag
UseCRISPRExpressionMammalianAvailable SinceJan. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-HaloSFPQ
Plasmid#166948PurposeLentiviral plasmid expressing Halo-tagged SFPQ protein from the EF1a promoterDepositorAvailable SinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available SinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
VP64-dCas9
Plasmid#177171PurposeVP64 fused to N-terminus of dCas9; pCDNA3 vector backbone, mammalian expressionDepositorInsertVP64-dCas9(D10A, H840A)
UseCRISPRTagsNLS and NLS-3xFLagExpressionMammalianPromoterCMVAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMAL
Plasmid#161783PurposeGateway destination vector with bidirectional CMV-PGK promoter for modest expression of gene of interest and GFP.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianPromoterBidirectional minhCMV and hPGKAvailable SinceDec. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTF101.3
Plasmid#134772PurposeA binary plasmid containing double CaMV 35S promoter to drive bialophos resistance gene (bar) for plant transformation.DepositorTypeEmpty backboneExpressionPlantAvailable SinceNov. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
GG-EBNA-OSK2M2L1-PP
Plasmid#102902PurposeEBNA episome plasmid for U6 promoter-driven expression of 10 gRNAs targeting OCT4, MYC, KLF4, SOX2 and LIN28A promoters. Includes PGK-puro selection cassette.DepositorInsertOSK2M2L1-gRNAs-PGK-puro
UseCRISPRExpressionMammalianPromoterU6Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-RTN3-WPRE-UbC-Emerald
Plasmid#233467PurposeLentiviral vector plasmid expressing human reticulon 3 (RTN3) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CKAP4 C100A-WPRE-UbC-Emerald
Plasmid#225949PurposeLentiviral vector plasmid expressing human CKAP4 mutation C100A under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorInsertsUseLentiviralExpressionMammalianMutationC100APromoterSFFV and UbCAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-Emerald
Plasmid#225951PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and Emerald under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-SFFV-CALU-WPRE-UbC-mCherry
Plasmid#225952PurposeLentiviral vector plasmid expressing human calumenin (CALU) under the spleen focus-forming virus (SFFV) promoter and mCherry under the Ubiquitin C (UbC) promoterDepositorAvailable SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pETM6-G6-vioABE
Plasmid#73438PurposeProdeoxyviolacein pathway (vioABE) in monocistronic configuration, transcriptionally driven by orthogonal T7-lac promoter variant G6.DepositorInsertPG6-vioABE
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterPG6 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK/CMV)
Plasmid#172330PurposeLV REPORT containing minimal promoter driving monomeric nuclear Tomato 2a HSVtk 2a Neo followed by an PGK/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorInsertsmonomeric nuclear Tomato
d2eGFP
HygR
UseLentiviral and Synthetic BiologyTags3x SV40 NLSExpressionMammalianPromoterPGK/CMVAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only