We narrowed to 15,730 results for: grna
-
Plasmid#180019PurposeTransiently expressing a nicking sgRNA to facilitate the introduction of HEK3 CTT insertion in PE3 approachDepositorInsertPrime editing ngRNA for HEK3-CTTins (EPHA8 Human)
UseCRISPRExpressionMammalianPromoterHuman U7Available SinceSept. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDF0430 huDisCas7-11-S1006-GGGS-D1221-U6-pro-Gluc
Plasmid#186987PurposeAAV transgene plasmid for Cas7-11-S1006-GGGS-D1221, with U6 promoter-driven expression of Gluc crRNA guideDepositorInsertcas7-11-s1006-gggs-d122, Gluc crRNA guide
UseAAVMutations1006-gggs-d1221 deletionAvailable SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_2
Plasmid#185017PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJuly 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_FDX1-2
Plasmid#184489PurposeLentivirus all in one CRISPR vector targeting human FDX1 geneDepositorInsertFDX1 (FDX1 Human)
UseLentiviralAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shIAPEz_1
Plasmid#185016PurposeshRNA mediated knockdownDepositorInsertERV_IAPEz
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3A
Plasmid#183283PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3A geneDepositorInsertDNMT3A
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_FGFR3
Plasmid#183291PurposeAll-in-One CRISPRko system with a guide RNA that targets FGFR3 geneDepositorInsertFGFR3
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-hPPM1A
Plasmid#185382PurposeFor mammalian expression of shRNA: AGGGTAATGGGTTGCGATATG that targets human PPM1ADepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_TOP1
Plasmid#183323PurposeAll-in-One CRISPRko system with a guide RNA that targets TOP1 geneDepositorInsertTOP1
UseLentiviralAvailable SinceMay 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PDGFRA
Plasmid#183313PurposeAll-in-One CRISPRko system with a guide RNA that targets PDGFRA geneDepositorInsertPDGFRA
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PARP1
Plasmid#183312PurposeAll-in-One CRISPRko system with a guide RNA that targets PARP1 geneDepositorInsertPARP1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH1
Plasmid#183300PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH1 geneDepositorInsertIDH1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorInsertHDAC2
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFTK093
Plasmid#171365PurposeVector part (LVL1) from the Fungal Modular Cloning ToolKit.DepositorInsertsgRNA transcription unit (MoClo lvl1 unit), P-gpdA-HH-sgRNA-HDV-Ttrpc, replacable LacZ gene
UseSynthetic BiologyExpressionBacterial and YeastMutationn/aAvailable SinceApril 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianPromoterU6Available SinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-RacFRET-U6ac-ctrl guides
Plasmid#168247Purpose"label active Rac; control for neutrophil-specific knockout"DepositorInsertRacFRET
UseZebrafish expressionPromoterLyzCAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
Circular 200,100 (mIDUA)
Plasmid#170123PurposeAAV vector carrying 2 copies of a guide RNA targeting the mouse IDUA mRNA, expressed from human and mouse U6 promotersDepositorInsertCircular 200,100 guide RNA (Idua Mouse)
UseAAVExpressionMammalianPromoterHuman U6 and mouse U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV.U6gLacZ.hSyn.flex.H2B.RFP
Plasmid#170373PurposeNegative control guide, Cre-inducible plasmid expressing nuclear RFP.DepositorInsertCre inducible H2B RFP
UseAAVPromoterhuman SynapsinAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_SDHA
Plasmid#177980Purposelentiviral vector expressing Cas9 and a sgRNA targeting SDHADepositorInsertsgRNA targeting SDHA (SDHA Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1_UQCRC2
Plasmid#177982Purposelentiviral vector expressing Cas9 and a sgRNA targeting UQCRC2DepositorInsertsgRNA targeting UQCRC2 (UQCRC2 Human)
UseLentiviralExpressionMammalianMutationN/APromoterU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only