We narrowed to 27,527 results for: cat
-
Plasmid#32736DepositorInsertCCND1 Promoter (CCND1 Human)
UseLuciferaseMutation-75 TCF(1) and -68 TCF(2) CTTTGATCTTTGCT deletion…Promoter-962 CCND1Available SinceJan. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEM-PH-citrine
Plasmid#131406PurposePurpose: synthesis of mRNA encoding a membrane marker. Insert: PH domain of the human phospholipase C delta 1 (PLCD1) fused with the yellow fluorescent protein mCitrineDepositorInsertPH
UseIn vitro transcriptionTagscitrine yellow fluorescent proteinPromoterT7Available SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
BII-gR-PtW-eSpCas9
Plasmid#133357PurposePiggybac vector for CRISPR/SpCas9 applications (nuclease, base editing, or epigenetic modifications). Provides gRNA and EspCas9 expressionDepositorInserteSpCas9
TagsHA-tagged eSpCas9ExpressionMammalianMutationeSpCas9 mutationsPromoterCMV enhancer and hEf1a (CpG free)Available SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGMC00013
Plasmid#172525PurposesgRNA against mouse Mr1DepositorAvailable SinceAug. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
DHCR7 B6.3 gRNA
Plasmid#90651Purpose3rd generation lentiviral gRNA plasmid targeting human DHCR7DepositorInsertDHCR7 (Guide Designation B6.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR SV40 mCherry L5-L2
Plasmid#62149PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a SV40 promoter and mCherry module. Compatible with MultiSite Gateway cloningDepositorInsertmCherry
UseMule gateway entry vectorExpressionMammalianPromoterSV40Available SinceFeb. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i1
Plasmid#59612PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-MAPRE1
Plasmid#31589DepositorInsertmicrotubule-associated protein, RP/EB family, member 1 (MAPRE1 Human)
TagsHis and TEVExpressionBacterialAvailable SinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
sgFFL
Plasmid#59877Purposesynthetic autoregulatory gene circuit made by inserting an intron containing the mouse mir-124–3 gene into mCherry. Contains the miR-124-regulated 3′UTR of the Vamp3 gene.DepositorInsertmCherry with intron containing the mouse mir-124–3
TagsPEST and VAMP 3 UTRExpressionMammalianPromoterdoxycycline (Dox)-inducible promoter (CMV/TO)Available SinceApril 1, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSF4 TetCMV intron 4xGCN4 Renilla FKBP STOP 24xMS2v5 SV40 CTE polyA
Plasmid#104984PurposeExpresses ST-Renilla reporter in mammalian cellsDepositorInsertRenilla luciferase
Tags24xMS2v5 stem loops in 3'UTR, 4xGCN4 repeats…ExpressionBacterial and MammalianPromoterTetCMVAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBS/U6/RNAi SadBs shRNA mouse
Plasmid#67152PurposepBS/U6 containing shRNA to mouse SADBsDepositorAvailable SinceNov. 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T-2 MED8
Plasmid#15436DepositorAvailable SinceAug. 10, 2007AvailabilityAcademic Institutions and Nonprofits only -
(B) HYG marker(R) (SBE264)
Plasmid#195013Purposehygromycin (HYG) resistance genes codon-optimized for R. toruloides and expressed under pXYL and tGPDDepositorInsertpXYL+HYG+tGPD
ExpressionBacterialPromoterpXYLAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
(B) BLE marker(R) (SBE262)
Plasmid#195012Purposebleomycin (BLE) resistance genes codon-optimized for R. toruloides and expressed under pXYL and tGPDDepositorInsertpXYL+BLE+tGPD
ExpressionBacterialPromoterpXYLAvailable SinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
DCT.VV.Orf166
Plasmid#12854PurposeThis plasmid was designed for screening purposes and may contain discrepancies relative to the current canonical GenBank version of the gene.DepositorInsertVV.Orf166
ExpressionMammalianAvailable SinceDec. 13, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMuLE ENTR U6 stuffer sgRNA scaffold L1-R5
Plasmid#62127PurposeMuLE (Multiple Lentiviral Expression) Entry vector containing a U6 promoter and sgRNA scaffold module for gRNA expression. Compatible with MultiSite Gateway cloningDepositorTypeEmpty backboneUseCRISPR; Mule gateway entry vectorExpressionMammalianAvailable SinceJune 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSicoR-PTPN11i2
Plasmid#59613PurposeExpression of shRNA against human PTPN11DepositorAvailable SinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
ath5:H2B-RFP
Plasmid#105960Purposetransgenesis, appears rather late, likely due to long RFP maturation time but is brighter than most other Ath5 constructDepositorAvailable SinceFeb. 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 UBXN11
Plasmid#169017PurposeExpresses GST-UBXN11 (human) in bacteriaDepositorAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only