We narrowed to 27,307 results for: GFP
-
Plasmid#205183PurposeExpresses chimeric rat CENP-O with mouse CENP-O middle region including central RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O middle regi…PromoterT7Available sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pGEMHE-RnCENP-O-298-GFP
Plasmid#205184PurposeExpresses chimeric rat CENP-O with mouse CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric rat CENP-O with mouse CENP-O C-terminal …PromoterT7Available sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmCENP-O-R298-GFP
Plasmid#205185PurposeExpresses chimeric mouse CENP-O with rat CENP-O C-terminal RWD domain; C-term tagged with GFP under T7 promoter - designed for in vitro transcriptionDepositorUseIn vitro transcriptionTags5 glycines linker followed by GFPExpressionMammalianMutationChimeric mouse CENP-O with rat CENP-O C-terminal …PromoterT7Available sinceOct. 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-msfGFP-ATG13 (1-197)
Plasmid#203560PurposeMammalian expression of GFP tagged ATG13 (1-197)DepositorAvailable sinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
C-SWAT GFP CL1 DAmP
Plasmid#182513PurposeC-SWAT compatible vector for C-terminal tagging with GFP CL1 followed by the DAmP cassette. The stop codon after the CL1 degron is immediately followed by the Hygromycin B (Hph) resistance cassette.DepositorInsertCL1 and DAmP
TagsGFPExpressionYeastAvailable sinceJan. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #2 GFP
Plasmid#106951PurposeLentivirus encoding sgRNA targeting murine Notch1. sgRNA is less optimal. Includes GFP marker.DepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV sgRNA-Notch1 #3 GFP
Plasmid#106952PurposeLentivirus encoding sgRNA targeting murine Notch1. sgRNA is less optimal. Includes GFP marker.DepositorAvailable sinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-DogTag Loop C
Plasmid#171781PurposeExpresses in bacterial cytoplasm superfolder GFP with DogTag and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-DogTag Loop C
TagsHis6ExpressionBacterialMutationDogTag and linkers inserted between residues Asp1…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop B
Plasmid#171777PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp102 and Asp103DepositorInsertsfGFP-SpyTag003 Loop B
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pET28-sfGFP-SpyTag003 Loop C
Plasmid#171778PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-SpyTag003 Loop C
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-GFP
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-QUASM1:GFPNLS-SV40pA
Plasmid#155116PurposeMiddle entry vector containing QUASM1 element upstream of GFP-NLS.DepositorInsertQUASM1:GFPNLS
UseGateway middle entry vectorPromoterQUASM1-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-GFP-I3(V41A/W43A)
Plasmid#61402PurposeExpresses GFP-tagged, PP1 binding-deficient Inhibitor-3 in mammalian cellsDepositorAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-13bCTS-GFP
Plasmid#247243PurposeA bacterial expression plasmid encoding ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acid 1-346,364-428PromoterT7 PromoterAvailable sinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-SET(1-218)
Plasmid#234707Purposeexpression of GFP in fusion with a C-terminally truncated SET proteinDepositorInsertSET (SET Human)
TagsAcGFPExpressionMammalianMutationexpresses only the N-terminal SET part (1-218)PromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta69-97
Plasmid#124924PurposeFor expression of a.a.69-97 deletion mutant of SIN1-GFPDepositorAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only