We narrowed to 15,009 results for: GRN
-
Plasmid#241308Purpose3rd gen lenti vector encoding dCas9 (s. Pyogenes) fused with the KRAB and a 2A eGFP fluorescence marker. Includes guide for suppression of the ZNF865 geneDepositorInsertZNF865 sgRNA (ZNF865 Human)
UseLentiviralAvailable SinceDec. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Torso
Plasmid#244933PurposeCRISPR gRNA targeting the C-terminal end of Torso for cleavage.DepositorInsertgRNA targeting Torso C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-Btl
Plasmid#244934PurposeCRISPR gRNA targeting the C-terminal end of Breathless for cleavage.DepositorInsertgRNA targeting Btl C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pU6-BbsI-EGFR
Plasmid#244932PurposeCRISPR gRNA targeting the C-terminal end of EGFR for cleavage.DepositorInsertgRNA targeting EGFR C terminus
UseCRISPRAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNC-Y
Plasmid#238998PurposeNode C carrying sgRNA-1 that can be used for the assembly of pEND-11Y or pEND-ZYDepositorInsertsgRNA-1 downstream of a weak constitutive promoter and a binding site for sgRNA-2
UseSynthetic BiologyExpressionBacterialMutationWTAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pML107-ZIM17
Plasmid#232901PurposePlasmid expressing Cas9 and gRNA AAATGTCTCACTTTGCAGTG which targets the ZIM17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL655
Plasmid#231165PurposeT-DNA encoding gRNA targeting SlPDSDepositorInsertgRNA targeting SlPDS
ExpressionPlantPromoterAtU6Available SinceJan. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Cdk13_intron4_sg4_pX330
Plasmid#127341PurposesgRNA that cuts within intron 4 of mouse CDK13 genomic locus- guide #4DepositorInsertMouse Cdk13 Intron 4 Targeting sgRNA
UseCRISPR and Mouse TargetingPromoterU6 PromoterAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm4
Plasmid#222909PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 4 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm3
Plasmid#222908PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 3 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm2
Plasmid#222907PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 2 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330_FIGLA_cterm1
Plasmid#222906PurposeCas9/sgRNA plasmid for targeting FIGLADepositorInsertCas9, FIGLA sgRNA 1 (FIGLA Synthetic, Human)
UseCRISPRAvailable SinceJuly 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pLV.5’eGFP/sgVIM
Plasmid#170548PurposeExpresses a sgRNA for 5' tagging to VIM and contains a cassette with eGFP without homology armsDepositorInsertsgRNA targeting 5'- end of VIM
UseCRISPR and LentiviralPromoterU6Available SinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXPR_023d-sgCiBIRC6-1
Plasmid#202447PurposeExpression of a CRISPRi guide targeting BIRC6DepositorAvailable SinceSept. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB4
Plasmid#197357PurposeA knock-out vector for dog ErbB4.DepositorInsertA gRNA targeting the dog ERBB4 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB1
Plasmid#197354PurposeA knock-out vector for dog ErbB1.DepositorInsertA gRNA targeting the dog EGFR gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-dErbB2
Plasmid#197355PurposeA knock-out vector for dog ErbB2.DepositorInsertA gRNA targeting the dog ERBB2 gene and the cDNA of CRISPR-Cas9
UseCRISPRExpressionMammalianAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only