We narrowed to 27,414 results for: gfp
-
Plasmid#171778PurposeExpresses in bacterial cytoplasm superfolder GFP with SpyTag003 and flanking linkers between Asp173 and Gly174DepositorInsertsfGFP-SpyTag003 Loop C
TagsHis6ExpressionBacterialMutationSpyTag003 and linkers inserted between residues A…PromoterT7Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS405 SEC66-VAC8-GFP
Plasmid#166840PurposeExpresses ER localized Vac8-GFP in yeasts. Made replacing the first 21 base pairs of the VAC8 ORF with the first 162 base pairs from the SEC66 ORF, which encode the Sec66 transmembrane domain.DepositorTagsGFP and SEC66 transmembrane domainExpressionYeastMutationSEC66 transmembrane domainPromoterVAC8 promoterAvailable sinceApril 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pME-QUASM1:GFPNLS-SV40pA
Plasmid#155116PurposeMiddle entry vector containing QUASM1 element upstream of GFP-NLS.DepositorInsertQUASM1:GFPNLS
UseGateway middle entry vectorPromoterQUASM1-E1bAvailable sinceSept. 14, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5FRT/TO-GFP-I3(V41A/W43A)
Plasmid#61402PurposeExpresses GFP-tagged, PP1 binding-deficient Inhibitor-3 in mammalian cellsDepositorAvailable sinceSept. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJBL7345
Plasmid#217372PurposesfGFP reporter for chimeric riboswitch with Cbe pfl ZTP riboswitch aptamer and WT Pca rhtB ZTP riboswitch expression platformDepositorPublicationInsertChimeric ZTP riboswitch with Cbe pfl aptamer and WT Pca rhtB expression platform sfGFP reporter
Available sinceNov. 22, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pGC452
Plasmid#19627DepositorInsertPhlh-12UseRNAi; Flp/frtExpressionWormAvailable sinceMarch 16, 2009AvailabilityAcademic Institutions and Nonprofits only -
pc2099-pEGFP-H3.1
Plasmid#241429PurposeExpresses human Histone H3.1 as fusion to GFP constructed by PCR using Primers: h3.1-cl-fw (AAGAATTCAATGGCTCGTACGAAGCAAAC) and h3.1-cl-rv (AAGCGGCCGCTGCCCTTTCCCCACGGATG) cloned into pEGFP-C1DepositorAvailable sinceJune 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
His-13bCTS-GFP
Plasmid#247243PurposeA bacterial expression plasmid encoding ciliary targeting sequence of mammalian Arl13b (amino acids 347-363) with N-terminal His and GFP-taggedDepositorInsertArl13B (ARL13B Human)
Tags6xHis and EGFPExpressionBacterialMutationdeleted amino acid 1-346,364-428PromoterT7 PromoterAvailable sinceJan. 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
GFP-SET(1-218)
Plasmid#234707Purposeexpression of GFP in fusion with a C-terminally truncated SET proteinDepositorInsertSET (SET Human)
TagsAcGFPExpressionMammalianMutationexpresses only the N-terminal SET part (1-218)PromoterCMVAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-nucGFP11-3xPax7gRNA
Plasmid#224570PurposeUbiquitous expression plasmid, CAG promoter (CMV immediate early enhancer, chicken beta actin promoter), three unique Pax7 gRNAs with ribozyme self-cleavage sites, and nuclear split GFP(11) reporter.DepositorInsertGFP11-H2B
UseCRISPRTagsHistone H2B (nuclear localization)MutationCodon optimizedAvailable sinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
wtVP1 + VP2C-GFPdeg
Plasmid#166678PurposeYeast integrative plasmid for expressing wild-type Murine polyomavirus VP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Wild-type Murine polyomavirus VP1
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
deltaVP1 + VP2C-GFPdeg
Plasmid#166677PurposeYeast integrative plasmid for expressing Murine polyomavirus deltaVP1 (GAL1 promoter) and destabilised GFP tagged with VP2C (GAL10 promoter). Contains uracil auxotrophic marker (K. lactis URA3).DepositorInsertsVP2C-GFPdeg
Murine polyomavirus deltaVP1 (NLS deletion mutant)
UseSynthetic BiologyExpressionYeastPromoterGAL1 and GAL10Available sinceApril 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTagGFP2-N SIN1 delta69-97
Plasmid#124924PurposeFor expression of a.a.69-97 deletion mutant of SIN1-GFPDepositorAvailable sinceMay 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
Tg 2 kb Violet opsin GFP
Plasmid#72921Purposeviolet opsin promoter from zebra finch (Taeniopygia guttata) gDNA (nucleotides21,946 to 145, corresponding to chr1A_ran-dom:206453–208444 in taeGut1) driving GFPDepositorInsertviolet opsin promoter
Available sinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pClneoEGFPC-let60 K16N
Plasmid#66861PurposeExpress GFP-tagged dominat negative let60, in which Lysine 16 is mutated to asparagine, in mammalian cellsDepositorInsertLet-60 (let-60 Nematode)
TagsGFPExpressionMammalianMutationLysine 16 is mutated to asparaginePromoterCMVAvailable sinceAug. 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBa.GFP-KIF1Bbeta tail 387-1770
Plasmid#134620PurposeMammalian expression of mouse KIF1Bbeta 387-1170DepositorInsertKIF1Bbeta (Kif1b Mouse)
TagseGFPExpressionMammalianMutationWT with deletion of the 386 N-terminal residues.PromoterChicken Beta actinAvailable sinceApril 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable sinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
GFP-APPL1-R146A/K152A/R154A
Plasmid#59767PurposeExpresses APPL1 Endosomal Localization MutantDepositorAvailable sinceSept. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pmyc-GFP-TNRC6A-NLS-mut
Plasmid#42000DepositorInsertTNRC6A (TNRC6A Human)
TagsEGFP and MycExpressionMammalianMutationR930A, R931A, R932A, R934APromoterCMVAvailable sinceMarch 6, 2013AvailabilityAcademic Institutions and Nonprofits only