We narrowed to 352 results for: pCDH
-
Plasmid#244312Purpose5' AAVLINK plasmid for PCDH11X expressionDepositorAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only
-
LLPS-pCDH-DDX6-CT
Plasmid#240014PurposeExpresses human DDX6-CT fused to EGFP in mammalian cellsDepositorInsertDDX6-CT (303-483)
UseLentiviralTags6xHis and EGFPAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LLPS-pCDH-DDX6-NT
Plasmid#240015PurposeExpresses human DDX6-NT fused to EGFP in mammalian cellsDepositorInsertDDX6-NT (1-302)
UseLentiviralTags6xHis and EGFPAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-TET1-S-WT
Plasmid#232942PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralAvailable SinceMay 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-no-Flag-TET1-S-WT
Plasmid#232941PurposeExpresses short isoform of TET1 in mammalian cells in its wild-type formDepositorInsertTET1-S-WT (TET1 Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5MF
Plasmid#232950PurposeExpresses ATP5MFDepositorInsertATP5MF (ATP5MF Human)
UseLentiviralAvailable SinceMarch 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-3_Flag-ATP5PB
Plasmid#232949PurposeExpresses ATP5PBDepositorInsertATP5PB (ATP5F1 Human)
UseLentiviralAvailable SinceMarch 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-CD20-Puro
Plasmid#209755PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 1 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#1/Cre
Plasmid#193229PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgPcdh15#2/Cre
Plasmid#193230PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Pcdh15 geneDepositorAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-pHCountdown
Plasmid#182301Purposelentiviral plasmid encoding pH-Countdown and puromycin selectionDepositorInsertpH countdown
UseLentiviralPromoterEF-1aAvailable SinceApril 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
PCDHGC5 sh1 shRNA
Plasmid#122227PurposeKnock Down Protocadherin gamma C5. It targets Protocadherin gamma C5 mRNA (nucleotides 851–871 in the protein coding region).DepositorInsertPCDHGC5 shRNA (Pcdhgc5 Rat)
UseRNAiAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
PCDHGC5 sh1 3m shRNA
Plasmid#122228PurposeNegative control shRNA (with 3-point mutations), for plasmid 122227: targeting Protocadherin gamma C5 mRNA.DepositorInsertPCDHGC5 shRNA (Pcdhgc5 Rat)
UseRNAiAvailable SinceMarch 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1S-copGFP
Plasmid#73034PurposeExpress copGFP reporterDepositorInsertcopGFP
UseLentiviralExpressionMammalianPromoterTruncated EF1Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EF1-IRES eGFP
Plasmid#128059PurposeLentiviral expression of an insert from EF1 promoter and co-expression of EGFP. See Depositor Comments for additional information regarding plasmid sequence.DepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceNov. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCDH-puro-CMV-VC3AI
Plasmid#78907PurposeIndicator of caspase-3-like protease activityDepositorInsertVC3AI
UseLentiviralTagsHA and MycMutationS320A, deletion of AA1-200PromoterCMVAvailable SinceJune 29, 2016AvailabilityAcademic Institutions and Nonprofits only