We narrowed to 5,947 results for: crispr cas9 expression plasmids
-
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
HF-PX459 (V2)
Plasmid#118632PurposePlasmid encoding SpCas9-HF1, a single guide RNA and puromycin resistanceDepositorInserthSpCas9-HF1-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationAsparagine 497 to Alanine, Arginine 661 to Alanin…PromoterCbhAvailable SinceDec. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA7
Plasmid#68466Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
PAX6 sgRNA2
Plasmid#68465Purposetargeting PAX6 geneDepositorAvailable SinceNov. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
HCP2
Plasmid#166104PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP3
Plasmid#166105PurposeThis plasmid encodes a Cas9 protein as well as a sgRNA that targets Msn2, which will create a double strand break and allow C-terminus tagging via homologous recombinationDepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
PB-Puro-U6-gRNA-pA plasmid
Plasmid#247671PurposespCas9 gRNA is driven by human U6 promoter, with the gRNA cassette between PuroR and pA, making it detectable in polyA-based RNA-seq.DepositorInsertPuromycin resistant gene
ExpressionMammalianPromoterTK promoterAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
cr3Dd
Plasmid#184862Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and a species-specific recombination systemDepositorInsertCas9, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Vn
Plasmid#184861Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an V. natriegens-specific recombination systemDepositorInsertCas9, gam, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
cr3Ec
Plasmid#184860Purposecr3 helper plasmid for recombination and Cas9 induction; harbors the Cas9 endonuclease and an E.coli-specific recombination systemDepositorInsertCas9, gam, bet, exo
TagsCas9 ssrA degradation tagExpressionBacterialAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCfB5191
Plasmid#126911PurposePlasmid containing gRNA expression cassettes targeting the X-4 and XII-5 integration sites in Saccharomyces cerevisiaeDepositorInsertX-4 and XII-5 gRNA
UseCRISPRAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHEY1.1.0-gDNA
Plasmid#112393PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor HEY1DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTFAP2C.1.0-gDNA
Plasmid#113792PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor TFAP2CDepositorAvailable SinceApril 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDDIT3.1.0-gDNA
Plasmid#112396PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DDIT3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_nat
Plasmid#184918PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_nat recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_mic
Plasmid#184920PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_mic recombines in vivo with a PCR product from pEasyG3_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_hph
Plasmid#184915PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_hph recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_mic
Plasmid#184916PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_mic recombines in vivo with a PCR product from pEasyG2_zeo/nat/hph.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_hph
Plasmid#184919PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_hph recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_zeo
Plasmid#184913PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_zeo recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceDec. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG3_zeo
Plasmid#184917PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG3_zeo recombines in vivo with a PCR product from pEasyG3_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMEL13
Plasmid#107919Purposekan based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL12
Plasmid#107918Purposehph based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS10
Plasmid#107924PurposeURA3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pX458-DsRed2
Plasmid#112219PurposeCloning backbone for sgRNA, co-expresses human optimized S. pyogenes Cas9 and DsRed2DepositorInsertDsRed2
UseCRISPRExpressionMammalianMutationDsRed2 contains a silent nucleotide substitution …Available SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pROS17
Plasmid#107931PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only