We narrowed to 3,025 results for: PHI-1
-
Plasmid#127385PurposeExpresses Cas9 at low levelDepositorInsertuORF(L)-Cas9
UseCRISPRExpressionInsectAvailabilityAcademic Institutions and Nonprofits only -
pEB2-mCherry2-L
Plasmid#104003PurposePlasmid encoding mCherry2-LDepositorInsertmCherry2-L
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGEE NNLA IIKEF… V…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUB-nSypHer (NLS:sypHer:NLS)
Plasmid#84731PurposeExpresses sypHer in plant cells-biosensor for pH targeted to NucleiDepositorInsertnSypHer
TagsNLS (nuclear localisation signal and NLS (nuclear…ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
-
UAS-u(S)Cas9
Plasmid#127383PurposeExpresses Cas9 at high levelDepositorInsertuORF(S)-Cas9
UseCRISPRExpressionInsectPromoterUASTAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(XL)Cas9
Plasmid#127386PurposeExpresses Cas9 at very low levelDepositorInsertuORF(XL)-Cas9
UseCRISPRExpressionInsectPromoterUASTAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(XXL)Cas9
Plasmid#127387PurposeExpresses Cas9 at very low levelDepositorInsertuORF(XXL)-Cas9
UseCRISPRExpressionInsectAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
UAS-u(XS)Cas9
Plasmid#127382PurposeExpresses Cas9 at very high levelDepositorInsertuORF-Cas9
UseCRISPRExpressionInsectAvailabilityAcademic Institutions and Nonprofits only -
UAS-FRT-GFP-FRT-u(M)Cas9
Plasmid#127388PurposeCas9 inducible by removal of a GFP flip-out cassetteDepositorInsertFRT-GFP-FRT-uORF(M)Cas9
UseCRISPRExpressionInsectAvailable SinceJune 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tol2-LyzC-TagRFP-T-EEA1
Plasmid#254776PurposeNeutrophil specific Early Endosome Antigen 1 expression in tol2 backboneDepositorAvailable SinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA2-5-HT2AR-isoformD
Plasmid#221824PurposePlasmid to express gRNA2 (ctgaagacataattacgtgg) for editing at the end of Drosophila 5-HT2AR isoform D coding frameDepositorInsertd5-HT2AR isoform D gRNA2 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pdU6-2_sgRNA1-5-HT2AR-isoformBFH
Plasmid#221825PurposePlasmid to express gRNA1 (cgctatcggtctgtgacaga) for editing at the end of Drosophila 5-HT2AR isoforms B, F and H coding frameDepositorInsertd5-HT2AR isoforms BFH gRNA1 (5-HT2 Fly)
UseCRISPRExpressionInsectPromoterzebrafish U6 promoter (U6b)Available SinceAug. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMtnA FLAG-IntS6 puro
Plasmid#195076PurposeExpresses FLAG-tagged Drosophila IntS6 from inducible MtnA promoterDepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 101-1284
Plasmid#195073PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 101-1284DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 1197-1284
Plasmid#195074PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 1197-1284DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUb FLAG-IntS6 AA 101-1200
Plasmid#195075PurposeExpresses FLAG-tagged Drosophila IntS6 amino acids 101-1200DepositorAvailable SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mScarlet
Plasmid#104006PurposePlasmid encoding mScarletDepositorInsertmScarlet
UseLow copyExpressionBacterialMutationMutations relative to DsRed (MSKGE AVIKEF… N6A, R…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3
Plasmid#104004PurposePlasmid encoding mRuby3DepositorInsertmRuby3
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEB2-mRuby3 Addgene
Plasmid#104005PurposePlasmid encoding mRuby3 AddgeneDepositorInsertmRuby3 Addgene
UseLow copyExpressionBacterialMutationMutations relative to eqFP611 (MSKGEE LIKENMRMKVV…PromoterproCAvailable SinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUB-nHyPer2 (NLS:HyPer2:NLS)
Plasmid#84730PurposeExpresses HyPer2 in plant cells-biosensor for Hydrogen peroxide targeted to NucleiDepositorInsertHyPer2 targeted to nucleus
TagsNLS (nuclear localisation signal and NLS (nuclear…ExpressionPlantPromoterubiqutin- 10 gene promoter (pUBQ10) of ArabidopsisAvailable SinceJuly 6, 2017AvailabilityAcademic Institutions and Nonprofits only -
pET32a-hAREG
Plasmid#199229PurposeBacterial production of soluble, active target proteins; Nterm thrombin and enterokinase cleavage sites.DepositorInsertAmphiregulin preproprotein (AREG Human)
TagsTrxA-6xHis-S-tagExpressionBacterialPromoterT7Available SinceMay 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
BS-ZJLEU-PTEF1-GFP
Plasmid#207018PurposeOver-expression of GFP under TEF1 promoter, use auxotrophic marker LEU2(Saccharomyces cerevisiae).DepositorInsertGFP
ExpressionYeastPromoterpTEF1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
PTPI1-Dsred-URA3
Plasmid#207017PurposeExpresses DsRed-Express 2 as a marker of cytosol, uses auxotrophic marker URA3(Saccharomyces cerevisiae).DepositorInsertDsRed-Express 2
ExpressionYeastPromoterpTPI1Available SinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Hygro DHFR.cHSF1
Plasmid#134738PurposeLentiviral expression vector for constitutively active HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202PromoterCMVAvailable SinceOct. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMS81(rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆)
Plasmid#154840PurposeInsertion of rpl-28p::mKate2::unc-54 3'UTR into a split hygromycin landing pad. Can be modified to insert a different gene(s) of interest.DepositorInserthomology arm:rpl-28p::mKate2::unc-54 3'UTR::LoxP::rps-0p::HYGR∆
UseCRISPR and Cre/LoxExpressionWormMutationHYGR∆ encodes aa 1-226Available SinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti CMV Puro DHFR.cHSF1
Plasmid#134739PurposeLentiviral expression vector for constitutively active HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202PromoterCMVAvailable SinceAug. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
EBFP2-UtrCH
Plasmid#124656PurposeF-actin marker. EBFP2 is fused to the calponin homology domain of utrophin (UtrCH).DepositorAvailable SinceMay 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mStayGold-TUBA1B
Plasmid#227321PurposeDonor template for Puro-2A-mStayGold insertion into the N-terminus of the TUBA1B locus. For tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B (Addgene #207763)DepositorInsertTUBA1B Homology Arms flanking a Puro-2A-mStayGold Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Puro-sTagRFP-TUBA1B
Plasmid#207769PurposeDonor template for Puro-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-sTagRFP-TUBA1B
Plasmid#207768PurposeDonor template for Blast-2A-sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-sTagRFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cav2.1 R57A, R59A pMT2
Plasmid#206112Purposeexpression of rat Cav2.1 calcium channel with R57A and R59A mutations that prevent G-protein modulationDepositorAvailable SinceNov. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-moxGFP-TUBA1B
Plasmid#207766PurposeDonor template for Blast-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Blast-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
GFP Cav2.2 D122A pcDNA3
Plasmid#206068Purposeexpression of rabbit Cav2.2 calcium channel with a N-terminal GFP tag and a D122A mutation that disrupts the interaction with ?2?-1DepositorAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307Y-pKK223
Plasmid#131381PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307Y in Gs MutY.DepositorInsertEcNGsC MutY chimera F307Y
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-F307A-pKK223
Plasmid#131382PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change F307A in Gs MutY.DepositorInsertEcNGsC MutY chimera F307A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are from…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308V-pKK223
Plasmid#131393PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308V in Gs MutY.DepositorInsertEcNGsC MutY chimera S308V
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
EcNGsC-S308A-pKK223
Plasmid#131394PurposeLow level expression of E.coli G.stearothermophillus MutY chimera protein with amino acid change S308A in Gs MutY.DepositorInsertEcNGsC MutY chimera S308A
ExpressionBacterialMutationFusion of two MutY genes. Residues 1-225 are fro…PromotertacAvailable SinceJan. 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral FL-15A
Plasmid#113011PurposeFor bacterial expression of MBP fusion of full-length Drosophila Tral with phosphomutations (15A)DepositorInsertfull length tral (tral Fly)
ExpressionBacterialMutation15 PNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMAL c2x Tral C 15A
Plasmid#113007PurposeFor bacterial expression of MBP fusion of C terminal region of Drosophila Tral phosphomutant (15A)DepositorInsertC terminus of tral (tral Fly)
ExpressionBacterialMutationPNG phosphorylation sites mutated to AAvailable SinceAug. 2, 2018AvailabilityAcademic Institutions and Nonprofits only