We narrowed to 167,150 results for: Gene
-
Plasmid#35112DepositorInsertlys5MX3
UseYeast replicatingAvailable SinceSept. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSLAX13 Flag (CT#231)
Plasmid#14026DepositorTypeEmpty backboneTagsFlagExpressionBacterialAvailable SinceFeb. 9, 2007AvailabilityAcademic Institutions and Nonprofits only -
pBS-ACTB-C200-T7
Plasmid#229850PurposeDonor vector for the ACTB site containing T7 sequence for detection of HR products.DepositorInsertPartial sequence of ACTB gene
UseHr donor vector for human actb gene.Available SinceJan. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti puro HA-TUBA1B
Plasmid#227587PurposeLentiviral plasmid expressing human TUBA1B proteinDepositorAvailable SinceNov. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryBFP.1
Plasmid#188013PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryBFP.2
Plasmid#188014PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryGFP.1
Plasmid#188016PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryGFP.2
Plasmid#188017PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-2aG4-gcryGFP.3
Plasmid#188018PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted 2aGal4VP16 protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-gcryBFP.1
Plasmid#187995PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker gamma crystallin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-gcryBFP.2
Plasmid#187996PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker gamma crystallin BFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-gcryGFP.1
Plasmid#187998PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
GBH-R-gcryGFP.2
Plasmid#187999PurposeCloning vector for conditional, intronic, targeted integration of a genebreak cassette optimized for zebrafishDepositorInsertTargeted mRFP protein trap; secondary marker gamma crystallin GFP
UseTargetable insertional mutagen and reporter systemPromoterEndogenuous Promoter; gamma crystallin promotorAvailable SinceMarch 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
ppie.001.301.W257A
Plasmid#137652PurposeExpresses N-terminal (His)6-Thrombin cleavage site fusion of human gene or portion of gene with point mutation in bacterial strains. pET based vector.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRPF4.001.522.K45A.pc4
Plasmid#137648PurposeExpresses nuclear localization signal (NLS), C-terminal myc-(His)6 fusion of human gene or portion of gene in human cell culture lines. pcDNA4.1-based vector.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
PRPF4.001.522.Y32A.pc4
Plasmid#137646PurposeExpresses nuclear localization signal (NLS), C-terminal myc-(His)6 fusion of human gene or portion of gene in human cell culture lines. pcDNA4.1-based vector.DepositorAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-hspa13
Plasmid#192730PurposeGateway entry vector encoding zebrafish hspa13DepositorAvailable SinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-dyrk1aa
Plasmid#192741PurposeGateway entry vector encoding zebrafish dyrk1aaDepositorAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-kcnj6
Plasmid#192725PurposeGateway entry vector encoding zebrafish kcnj6DepositorInsertkcnj6 (kcnj6 Zebrafish)
UseGateway entry vectorMutation5' insertion of ATGGCCAAGCTGACAGAATCC, ident…PromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-ets2
Plasmid#192724PurposeGateway entry vector encoding zebrafish ets2DepositorInsertets2 (ets2 Zebrafish)
UseGateway entry vectorMutationN189D (rs502796915); S231NPromoterNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSDest-ENTR-MCP-ADAR2-DD(E488Q/T490A)-V5
Plasmid#192714PurposeMammalian expression vector containing MS2 coat protein fused to ADAR2 catalytic domain (E488Q/T490A) with V5 tagDepositorInsertMCP-ADAR2-DD(E488Q/T490A)-V5
TagsV5ExpressionMammalianMutationE488Q/T490APromoterCMVAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Rosa26-cre_dre_reporter_1_2
Plasmid#185966PurposeB6J Rosa26-cre dre reporter 1.2 allele targeting vector, low copy numberDepositorInsertsfGFP, tdTomato
UseCre/Lox and Mouse Targeting; Dre/roxExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Rosa26-cre_dre_reporter_1_1b
Plasmid#185965PurposeB6J Rosa26-cre dre reporter 1.1b allele targeting vector, low copy numberDepositorInsertsfGFP, tdTomato
UseCre/Lox and Mouse Targeting; Dre/roxExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Rosa26-cre_dre_reporter_1_1a
Plasmid#185964PurposeB6J Rosa26-cre dre reporter 1.1a allele targeting vector, low copy numberDepositorInsertsfGFP, tdTomato
UseCre/Lox and Mouse Targeting; Dre/roxExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pB6-Rosa26-cre_dre_reporter_1_1
Plasmid#185963PurposeB6J Rosa26-cre dre reporter 1.1 allele targeting vector, low copy numberDepositorInsertEGFP, tdTomato
UseCre/Lox and Mouse Targeting; Dre/roxExpressionMammalianAvailable SinceJuly 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCLIP23
Plasmid#125144PurposeGeneral purpose cloning vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLIP8
Plasmid#125140PurposeGeneral purpose cloning vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLIP9
Plasmid#125141PurposeGeneral purpose cloning vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLIP19
Plasmid#125143PurposeGeneral purpose cloning vectorDepositorTypeEmpty backboneExpressionBacterialAvailable SinceJune 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJK573
Plasmid#72456PurposeProduces Yersinia pestis N5-carboxyaminoimidazole ribonucleotide mutase with N-terminal TEV protease-cleavable His6 tag (H6tYpPurE1), synthetic geneDepositorInsertN5-carboxyaminoimidazole ribonucleotide mutase
TagsHis6 and TEV cleavage siteExpressionBacterialMutationsynthetic gene with ~57 silent substitutionsPromoterT7Available SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJK587
Plasmid#71696PurposeProduces Acetobacter aceti 1023 thioredoxin reductase 1 with a C-terminal His6 tag and Cys138>Ser mutant (AaTrxB1H6-C138S)DepositorInsertthioredoxin reductase 1
TagsHis6ExpressionBacterialMutationchanges cysteine-138 to serinePromoterT7Available SinceJan. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSA54
Plasmid#35113DepositorInsertcallys5MX3
UseYeast replicatingAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSA49
Plasmid#35118DepositorInsertcallys5MX4
UseYeast replicatingAvailable SinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSA52
Plasmid#35119DepositorInsertcallys5MX3
UseYeast replicatingAvailable SinceSept. 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pSA50
Plasmid#35111DepositorInsertcalys5MX4
UseYeast replicatingAvailable SinceAug. 29, 2012AvailabilityAcademic Institutions and Nonprofits only -
Lenti-multi-Guide
Plasmid#85401PurposeLentiviral vector for the delivery of multiple sgRNAs targeting different genes in combination with inducible Cas9 expresssion by pLenti-iCas9-neoDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralAvailable SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX-TRE-dCas9-KRAB-MeCP2-BSD
Plasmid#140690PurposeInducible knockdown of gene expression in human cells for pooled scRNA-seq experimentsDepositorInsertCas9m4-KRAB-MeCP2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYL156 (TRV RNA2)
Plasmid#148969PurposeModified Tobacco Rattle Virus RNA 2; used for virus induced gene silencing in plants along with pYL192 (TRV RNA1)DepositorInsertModified TRV RNA2
UseT-dna vectorMutationsee comments section belowAvailable SinceJune 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pVSe
Plasmid#234896PurposeAll-in-one plant virus expression vector for virus-induced gene silencing (VIGS) and virus-mediated overexpression (VOX)DepositorTypeEmpty backboneExpressionPlantAvailable SinceJune 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMβ1
Plasmid#216202PurposeChromosomal gene manipulation (gene insertion, conversion, deletion) of dairy used Lactobacillus bulgaricus, a difficult gene to manipulate, is now possible by conjugation using this pGMB1 plasmid.DepositorTypeEmpty backboneUseShuttle vector, conjugal plasmid, theta type rep…ExpressionBacterialPromoterlac promoter in pGEM-Teasy, Promoters in pAMbeta1…Available SinceJan. 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits