-
Plasmid#229839PurposeA CAGGS driven, piggybac compatible, tet-on expression vector containing a luciferase reporter followed by a P2A cleavage peptide and H2A fused mCherry for nuclear labeling.DepositorInsertLuciferase
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
p5E-MCS-c-Fos-b-globin (JDW 1237)
Plasmid#229829PurposeA gateway compatible 5' entry clone containing an MCS upstream of the murine c-fos minimal promotor and b-globin intron.DepositorInsertc-fos minimal promoter and b-globin intron
UseGateway entry cloneTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME Actin Vhh Halo Tag (JDW 1223)
Plasmid#224498PurposeGateway compatible middle entry clone containing an Actin nanonbody fused to a flexible linker and Halo Tag (For visualizing actin, actin chromobody)DepositorInsertActin-Vhh-Halo-Tag
UseGateway cloningTagsExpressionMutationPromoterAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMIR-Dsred-IRES-His-Halo-Tev-Keap C151S/C288S
Plasmid#62460Purposeexpresses C151S and C288S double mutant human Keap1 proteinDepositorInsertKeap1 (KEAP1 Human)
UseTagsHis-Halo-TevExpressionMammalianMutationChanged Cysteines 151 and 288 of Keap1 to respect…PromoterCMVAvailable sinceMarch 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
R702-X31-566: His6-MBP-tev-G-Hs.PDE6D(2-150)
Plasmid#159689PurposeE. coli protein expression of His6-MBP-tev-G-Hs.PDE6D(2-150)DepositorInsertHis6-MBP-tev-G-Hs.PDE6D(2-150) (PDE6D Human)
UseTagsHis6-MBP-tevExpressionBacterialMutationPromoterAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SARS-CoV2-NP-Nt(47-173)
Plasmid#165091Purposeprotein expression in E. coliDepositorInsertSevere acute respiratory syndrome coronavirus 2 nucleocapsid protein N-terminal(47-173) (N SARS-CoV2)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 22, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pT2/GD-IRES-GFP-CTNNB1
Plasmid#192868PurposeCarries a Sleeping Beauty (SB) transposon vector that can be used to deliver an activated human CTNNB1(S33Y) transgene into cells, when a source of SB transposase is also co-introduced.DepositorInsertsluc+
EGFP
CTNNB1
UseTagsExpressionMammalianMutationPromoterAvailable sinceMay 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET32a-Spike-S-4P
Plasmid#165094Purposeprotein expression in E. coliDepositorInsertSevere acute respiratory syndrome coronavirus 2 spike protein site 550-570, 785- 805, 810-830 and 1146 1166 (S SARS-CoV2)
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 2, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
CAG-GCaMP6f-3x-miR204-5p-3x-miR122-TS
Plasmid#117384PurposeAn AAV genome containing miRNA target sequences (TS) 204-5p and 122 to reduce expression of GCaMP6f in astrocytes and hepatocytes, respectivelyDepositorInsertGCaMP6f + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA ; 3 copies of miR122 : CAAACACCATTGTCACACTCCA
UseAAVTagsExpressionMammalianMutationPromoterCAGAvailable sinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET30a-SARS-CoV2-ORF3b (S23Q)
Plasmid#165088Purposeprotein expression in E. coliDepositorInsertSevere acute respiratory syndrome coronavirus 2 ORF3b (S23Q)
UseTagsExpressionBacterialMutationStop codon to glutamine at 23rd amino acidPromoterAvailable sinceFeb. 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
pET32a-Spike-403-505
Plasmid#165095Purposeprotein expression in E. coliDepositorInsertSevere acute respiratory syndrome coronavirus 2 spike protein site 403-505 (S SARS-CoV2)
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 10, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
R725-X09-635: His6-tev-Hs.SPRED1(13-125)
Plasmid#159581PurposeBaculovirus protein expression of His6-tev-Hs.SPRED1(13-125)DepositorInsertHis6-tev-Hs.SPRED1(13-125) (SPRED1 Human)
UseTagsHis6-tevExpressionInsectMutationPromoterAvailable sinceSept. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
p5E-Dll4-F2-E1B-B-Globin (JDW 1366)
Plasmid#229843PurposeA gateway compatible 5' entry clone containing the murine Dll4 F2 arterial specific enhancer upstream of a minimal E1b promoter and intron for arterial and endocardial expression.DepositorInsertDll4-F2 (exon3)
UseGateway entry cloneTagsExpressionMutationPromoterAvailable sinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lexPR-nls-GFP-pA (JDW 1316)
Plasmid#229811PurposeA Tol2 based expression vector for RU486 inducible expression of GFP in the nucleus (1st generation)DepositorInsertLexA transactivator-LexA-Operon-nls-GFP
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-nls-mCherry-stop-IRES-myr-EGFP (JDW 1326)
Plasmid#229812PurposeA CAGGS driven expression vector containing an nls-mCherry followed by an IRES and then a myristoylated EGFP for labeling the cell membrane.DepositorInsertnls-mCherry
UseTagsSV40 NLSExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-Ubi-lexA-oMDC-pA-lexO-cFos-nlsGFP-pA (JDW 1382)
Plasmid#229813PurposeA Tol2 based expression vector for RU486 inducible expression of GFP in the nucleus with a destablized lex transactivator and a c-fos minimal promoter.DepositorInsertLexA-mODC-LexAOp-cFos
UseTol2 based expression vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-Hsp70-zCreI-mTagBFP2d-2xins (JDW 1002)
Plasmid#229817PurposeA gateway compatible Tol2 destination vector containing the Hsp70 promoter driving Cre and TagBFP followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Tet-Off-FLEX-DEST (JDW 1186)
Plasmid#229820PurposeAn AAV, tet-off, gateway compatible destination vector with cre dependent expression of the insert. EFS driving destablized rTADepositorTypeEmpty backboneUseAAVTagsExpressionMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAGEN-Luciferase-P2A-H2A-mCherry (JDW 1129)
Plasmid#229823PurposeA CAGGS driven luciferase reporter followed by a P2A cleavage peptide and an H2A mCherry cassette for nuclear labeling.DepositorInsertLuciferase-P2A-H2A-mCherry
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTol2-DEST-hsp70-zCreI-BFP (JDW 1184)
Plasmid#229831PurposeA gateway compatible Tol2 destination vector containing the hsp70 promoter driving Cre and TagBFP in endothelial cells followed by 2 cHS4 insulator cores.DepositorTypeEmpty backboneUseTol2 destination vectorTagsExpressionMutationPromoterAvailable sinceFeb. 13, 2025AvailabilityAcademic Institutions and Nonprofits only