We narrowed to 31,550 results for: Eng;
-
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable sinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only
-
CYLBL_Neo_CAGdCas9-KRAB
Plasmid#220439PurposeCAG-dCas9-KRAB knock-in using TALEN at CLYBL locusDepositorInsertdCas9
UseCRISPR and TALENTagsKRABExpressionMammalianMutationD10A and H840APromoterAvailable sinceJune 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
U6-sgR26-eCas9-T2A-BlastR
Plasmid#172493PurposeFor CRISPR-assisted HDR, Rosa26 locusDepositorInserteCas9, BlastR and sgRNA targeting the Rosa26 (R26) safe harbor locus
UseCRISPR, Lentiviral, and Mouse TargetingTagsExpressionMutationPromoterAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9-HF1-P2A-EGFP (LM422)
Plasmid#197505PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e A-to-G base editor with nSpCas9-HF1(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e-nSpCas9-HF1-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA and nSpCas9-HF1(D10A/N497…PromoterCMV and T7Available sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pU6-crRNA(SOD1)
Plasmid#109321PurposeAAV vector expressing crRNA for AsCpf1 (RR variant) targeting human SOD1DepositorInsertmCherry-KASH (SOD1 Human)
UseAAVTagsExpressionMutationPromoterhSyn1Available sinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
MKC86_HBA1(tEPOR-2A-YFP)
Plasmid#232405PurposeAAV production plasmid for tEPOR-2A-YFP vector from Fig. 2 that mediates HDR at HBA1 locus using HBA1-sg4 gRNA. HBA1 UTRs flank full tEPOR-2A-YFP cassette. Homology arms mediate full HBA1 replacement.DepositorUseAAVTagsExpressionMammalianMutationPromoterAvailable sinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
LV-PGK-PVR-P2A-Cre-EFS-mScarletSIIN
Plasmid#172435PurposeLentivirus, expresses Cre recombinase, mouse PVR (CD155), and mScarlet-SIINFEKLDepositorInsertsCre
PVR
mScarlet-SIINFEKL(OVA257-264)+Ova 323-339
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJune 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYJA5
Plasmid#217778PurposeThe empty vector for quadruple sgRNA cloningDepositorTypeEmpty backboneUseCRISPR, Lentiviral, and Synthetic BiologyTagsPuromycin resistance gene, T2A, and TagBFPExpressionMammalianMutationPromoterPGK, CMV, U6Available sinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8.20m-SpCas9-NRTH-P2A-EGFP (RMD63)
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available sinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-CE-ABE8e-SpRY--BPNLS-P2A-EGFP (NK289)
Plasmid#208293PurposeCMV and T7 promoter expression plasmid for human codon optimized CE-ABE8e-SpRY A-to-G base editor and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-CE-ABE8e-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations in TadA inlaid into nSpRY(D10A/A6…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP (CA136)
Plasmid#208291PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE8e(V106W) A-to-G base editor with SpRY(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8e(V106W)-SpRY-BPNLS-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-P2A-EGFPExpressionMammalianMutationABE8e mutations and V106W in TadA and nSpRY(D10A/…PromoterCMV and T7Available sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPRoff-mScarletI
Plasmid#217783PurposeExpresses CRISPRoff-mScarletI (DNMT3A-DNMT3L-XTEN80-dCas9-HA-2xNLS-mScarletI-KRAB) downstream of the CAG promoter for gene epigenetic silencingDepositorInsertCRISPRoff-mScarletI (DNMT3A-DNMT3L-dCas9-mScarletI-KRAB)
UseTags2xNLS, DNMT3A-DNMT3L, HA, KRAB, and mScarletIExpressionMammalianMutationPromoterCAGAvailable sinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
XE92 XGCNF-EnR
Plasmid#17029DepositorInsertXGCNF-EnR (en Fly)
UseXenopus expressionTagsExpressionMutationPromoterAvailable sinceMarch 14, 2008AvailabilityAcademic Institutions and Nonprofits only -
hNTa2-qgRNA-pYJA5
Plasmid#217780PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTa1-qgRNA-pYJA5
Plasmid#217779PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.gonfio library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene activation and epigenetic silencing
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTo1-qgRNA-pYJA5
Plasmid#217781PurposeNon-targeting control 1 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
hNTo2-qgRNA-pYJA5
Plasmid#217782PurposeNon-targeting control 2 qgRNA-pYJA5 plasmid from the T.spiezzo library; it can be used as a ready-to-go control and provides the three constant regions for the three-fragment PCRs for qgRNA cloningDepositorInsertQuadruple sgRNA-expression cassette for nontargeting control for gene ablation
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterhuman U6, mouse U6, human H1, human 7SKAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pLIA EnR (CC#29)
Plasmid#15152DepositorInsertEngrailed repressor (en Fly)
UseRetroviralTagsExpressionMammalianMutationengrailed repressor domainPromoterAvailable sinceJune 15, 2007AvailabilityAcademic Institutions and Nonprofits only -