We narrowed to 5,716 results for: KRAS
-
Plasmid#128224Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH113
Plasmid#128210Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 2
Plasmid#59975PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pFH51
Plasmid#128213Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU3 promoter module (pFH38)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-ZKSCAN1 548-1047
Plasmid#69903PurposeExpresses a miniature version of the ZKSCAN1 circular RNA in mammalian cellsDepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-WDR5 shRNA 4
Plasmid#59977PurposeKnockdown of WDR5DepositorInsertWDR5 shRNA
UseRetroviralAvailable SinceOct. 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) ZKSCAN1 MCS-GFP 5' Half Only
Plasmid#69907PurposeExpresses a circular RNA containing the 5' half of GFP in mammalian cellsDepositorAvailable SinceOct. 22, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSuper.Retro.Puro-PKN1 shRNA 4
Plasmid#59978PurposeKnockdown of PKN1DepositorInsertPKN1 shRNA
UseRetroviralAvailable SinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
Desmocollin2_tail-GST
Plasmid#36992DepositorInsertDsc2 (DSC2 Human)
TagsGSTExpressionBacterialMutationIntracellular domain of Dsc2 (nt 2,603–3,158)Available SinceJuly 31, 2012AvailabilityAcademic Institutions and Nonprofits only -
pFH71
Plasmid#128214Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU6 promoter module (pICSL90003)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+) Laccase2 Sense
Plasmid#69892PurposeExpresses the Drosophila laccase2 exon 2 circular RNADepositorAvailable SinceOct. 21, 2015AvailabilityAcademic Institutions and Nonprofits only -
Human NCKX3 (pcDNA3.1+)
Plasmid#75205PurposeMammalian expression of SLC24A3DepositorAvailable SinceJune 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGMF1-D
Plasmid#242205PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 1st 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA1 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGMF2-D
Plasmid#242206PurposeAtU6-26p::sgRNA scaffold in L1 vector backbone, for subcloning of 2nd 20 bp target sequence. For use in dicots.DepositorInsertLevel1 AtU6-26p::sgRNA2 for subcloning of 20 bp target sequence
UseCRISPR and Synthetic BiologyExpressionPlantPromoterAtU6-26pAvailable SinceNov. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIRES2_hMela(CT+IL3 mGluR6)
Plasmid#191343PurposeOptogenetic toolDepositorInserthMela(CT+IL3 mGluR6)
TagsIRES_TurboExpressionMammalianAvailable SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRMutationS264A, and silent mutation to remove PAM siteAvailable SinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
FoxFTVC+bpFOG_MRAS-G22V
Plasmid#107521PurposeConstitutive activation of FGF/MAPK pathway by M-Ras-G22V mutantDepositorInsertM-Ras protein
Mutationchanged Glycine 22 to ValinePromoterTVC-specific FoxF enhancer (FoxFTVC+bpFOG)Available SinceApril 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH50
Plasmid#128212Purposeimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)DepositorInsertimproved sgRNA backbone for tRNA-gRNA array, Position 1, combine with OsU6-2 promoter module (pFH36)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAK007
Plasmid#128220Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with TaU3 promoter module (pFH31)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH72
Plasmid#128221Purposeclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)DepositorInsertclassic sgRNA backbone for tRNA-gRNA array, Position 1, combine with AtU6-26 promoter module (pFH34)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only