We narrowed to 1,531 results for: Green fluorescence protein
-
Plasmid#220189PurposesgRNA expression vector - pEM7 promoter with GFP in sgRNA siteDepositorInsertpEM7 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpEM7Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpyD-GFP
Plasmid#220192PurposesgRNA expression vector - pBG28 promoter with GFP in sgRNA siteDepositorInsertpBG28 promoter with GFP in sgRNA site
UseCRISPRExpressionBacterialMutationmonomeric superfolder green fluorescent proteinPromoterpBG28Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJEP222-AAV-CMV-GFP-pA
Plasmid#62916PurposeAAV vector backbone designed to express GFP from a CMV promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoterCMVAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP220-AAV-0.5Synapsin-GFP-pA
Plasmid#62920PurposeAAV vector backbone designed to express GFP from a 0.5Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter0.5synapsinAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP219-AAV-1.1Synapsin-GFP-pA
Plasmid#62921PurposeAAV vector backbone designed to express GFP from a 1.1Synapsin promoter. It also contains a poly-Adenylation Signal (pA)DepositorInsertGreen Fluorescent protein (GFP)
UseAAVPromoter1.1SynapsinAvailable SinceMarch 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP214-Lenti-0.5Synapsin P-GFP- WPRE-pA
Plasmid#62929PurposepLenti vector backbone designed to express GFP from a 0.5Synapsin promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter0.5synapsin and 1.3αCaMKIIAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP215-Lenti-0.4CaMKIIa P-GFP-WPRE-pA
Plasmid#62927PurposepLenti vector backbone designed to express GFP from a 0.4CaMKIIa promoter.DepositorInsertGreen Fluorescent protein (GFP)
UseLentiviralPromoter0.4αCaMKII and 1.3αCaMKIIAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
p-sfGFP-pA-FRT-Amp-FRT
Plasmid#176620Purposefor generating PCR templates with sfGFP and Amp for BAC recombinationDepositorInsertsuper folder green fluorescent protein with FRT-flanked ampicillin cassette
UseUnspecifiedMutationH217R - please see dep. commentsAvailable SinceNov. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCRII-TOPO CMV-cGFP-SV40 pA + Laccase2 Exon 2
Plasmid#91802PurposeExpresses the Laccase2 circular RNA when the upstream SV40 poly(A) signal fails to be usedDepositorInsertCoral Green Fluorescent Protein (cGFP)
ExpressionMammalianPromoterCMVAvailable SinceMarch 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-X2
Plasmid#115567PurposeGFP tethered to two repeats of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastMutationTwo repeats of the Gcn5 consensus motif are tagge…PromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
GFP-X1
Plasmid#115566PurposeGFP tethered to a single repeat of the Gcn5 consensus motifDepositorInsertGreen Fluorescent Protein
ExpressionBacterial and YeastMutationSingle Gcn5 consensus motif repeat tethered to C-…PromoterADH1Available SinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
Iron Insensitive Control Construct 2
Plasmid#243007PurposeIron Insensitive Control Construct under the same expression promoter used in IronFistDepositorInsertsmNeonGreen
T2A
mCherry
UseGatewayExpressionMammalianAvailable SinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CMV-CAG-GFP-EnvA(N2c)
Plasmid#194353PurposeLentivirus expressing eGFP and (EnvA-N2c Rabies Glycoprotein) fusion protein. Used to package EnvA pseudotyped G-deleted Rabies of CVS-N2c strainDepositorInsertsEnhanced Green Fluorescent Protein (eGFP)
EnvA-CVS-N2c Rabies Glycoprotein
UseLentiviralAvailable SinceAug. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDN-T2dGZmxh
Plasmid#44552DepositorInsertsPTETREG promoter
yEGFP::ZeoR
UseSynthetic Biology; Expression regulator/reporterExpressionYeastPromoterPTETREGAvailable SinceApril 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
pGLO-GFP-1UAG
Plasmid#82500PurposeExpresses GFP with 1 UAG codon at the amino acid position 3DepositorInsertGreen Fluorescent Protein with 1 UAG codon
ExpressionBacterialMutationAdded an UAG codon at the amino acid position 3PromoterAraBADAvailable SinceSept. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pGEM-GFP-URA3-GFP
Plasmid#72606PurposeTemplate for creating a C-terminal GFP tag AND an internal GFP tag from a single transfection of yeastDepositorInsertsGFP (full)
URA3
GFP (partial)
Optional Linker
MutationIncludes full 819 bp coding sequence of URA3, 435…Available SinceJan. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2-MfnG-EcYRS-EGFP*
Plasmid#191119PurposeA plasmid for incorporation of O-Me-Tyr into an EGFP reporter without O-Me-Tyr feeding for zebrafishDepositorInsertMfnG - P2A - Mutant E. coli TyrRS - T2A - enhanced green fluorescence protein
TagsHis tagExpressionMammalianAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
p1.2-GS-eGFP
Plasmid#162771PurposeFluorescent reporter for CHO expression studiesDepositorInsertenhanced green fluorescent protein
ExpressionMammalianMutationconsensus Kozak sequence (GCCGCCATGG) added befor…PromoterCHO EEF1A1 (Translation Elongation Factor 1 Alpha…Available SinceAug. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-EGFP
Plasmid#114213PurposeAAV vector (control) that targets expression of EGFP to neuronsDepositorInsertEnhanced Green Fluorescent Protein
UseAAV and Mouse TargetingTagsNoneExpressionMammalianMutationNonePromoterhuman synapsin (hSyn)Available SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only