We narrowed to 83,057 results for: Mycs

#200191

A TETon activator, which combined with the DiLiCre 2.0 plasmid, drives the expression of DiLiCre 2.0 upon doxycycline. DiLiCre 2.0 is a cre recombinase that is activated by violet light.

Jacco van Rheenen

Vizoso et al Nat Commun. 2022 Oct 28;13(1):6442. doi:

Aug. 30, 2023

Academic Institutions and Nonprofits only

#50587

CRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (AtU6-26 promoter), Hyg resistance

Qi-Jun Chen

Xing et al BMC Plant Biol. 2014 Nov 29;14(1):327.

Dec. 11, 2014

Academic Institutions and Nonprofits only

#87402

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87399

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1309a sequence CCTGTGGTGACTACGTATCC in yeast chromosome 13.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87401

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YOLCd1b sequence GACTAGTTAAGCGAGCATGT in yeast chromosome 15.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87400

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1414a sequence GCGCCACAGTTTCAAGGGTC in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#89759

Human ZMPSTE24 mammalian expression vector. Retroviral bicistronic puromycin vector.

Martin Dorf

Fu et al J Exp Med. 2017 Feb 28. pii: jem.2016127

June 8, 2017

Academic Institutions and Nonprofits only

#228356

Landing pad with Bxb1 attP_wildtype site, Dox-inducible BFP-iCasp9-Blasticidin, CMV-driven rtTA3, T2A-neomycin for HDR into AAVS1 locus

Arvind Rasi Subramaniam

Nugent et al Nat Methods. 2025 Jun;22(6):1237-1246. d

Jan. 2, 2025

Academic Institutions and Nonprofits only

#236416

For plant prime editing including large DNA fragment editing in Nicotiana benthamiana or other dicotyledons

Zong Yuan

Zhao et al Nat Plants. 2025 Feb;11(2):191-205. doi:

Oct. 7, 2025

Academic Institutions and Nonprofits only

#216160

Plasmid expressing the RME1(ins-308A) and MKT1(30G) genes from S. cerevisiae to correct sporulation defect of S288C derived yeast lab strains

Grant Brown

Loll-Krippleber et al Yeast. 2024 Sep 9. doi: 10.1002/yea.3978

May 30, 2024

Academic Institutions and Nonprofits only