We narrowed to 4,504 results for: pcr
-
Plasmid#188325PurposePCR template for repair templates to tag a gene with a GFP and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::GFP::mIAA7
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS008
Plasmid#188331PurposePCR template for repair templates to tag a gene with a wrmScarlet and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::wrmScarlet::mIAA7
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pADH110
Plasmid#90982PurposeNAT-marked pSNR52 promoter fragment for use in gRNA expression cassette stitching PCR; for use with pADH119, 139, or 147 to generate target-specific gRNA expression cassette.DepositorInsertsNAT 2 of 2
pSNR52
UseCRISPRTagsExpressionMutationPromoterAvailable sinceJune 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJJS006
Plasmid#188329PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mNeonGreen::mIAA7
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS005
Plasmid#188328PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mNeonGreen::Linker
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hygro-mNG
Plasmid#179819PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedTagsExpressionMutationPromoterread throughAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-mScarlet-MCS-polyA
Plasmid#174023PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertmScarlet
UseZebrafish knock-in taggingTagsExpressionMutationPromoterAvailable sinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-mScarlet-MCS-polyA
Plasmid#174029PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-mScarlet
UseZebrafish knock-in taggingTagsExpressionMutationPromoterAvailable sinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJS009
Plasmid#188332PurposePCR template for repair templates to tag a gene with a mKate2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mKate2::Linker
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS003
Plasmid#188326PurposePCR template for repair templates to tag a gene with a mCherry and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mCherry::Linker
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
LBJJ382
Plasmid#117518PurposeAlso known as LBJJ429. PCR template for sgRNA-EF with polyT, 67bp or 192bp terminatorDepositorInsertBpiI:ACTA:pU6-26:sgRNA-EF:t192bp:TTAC:BpiI
UseCRISPRTagsExpressionPlantMutationPromoterAtU6-26Available sinceOct. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-tdTomato
Plasmid#179794PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserttdTomato
UseUnspecifiedTagsExpressionMutationPromoterread throughAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCY 3090-06
Plasmid#36233DepositorInsertURA3
UseYeast cassette for pcr and homologous recombinati…TagsyEpolylinker-mCherry-URA3ExpressionMutationPromoterAvailable sinceAug. 9, 2012AvailabilityAcademic Institutions and Nonprofits only -
M-SP-sgRNA
Plasmid#48671PurposeMammalian U6-driven sgRNA (SPm) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with S. pyogenes Cas9, hU6 promoter
UseCRISPRTagsExpressionMutationPromoterhU6Available sinceNov. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pTopo pLox hPGK-Puro pA pLox
Plasmid#171048PurposeEmpty donor template for CRISPR/Cas9 targeting of TERT RE'sDepositorTypeEmpty backboneUseCre/LoxTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-eGFP
Plasmid#179781PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInserteGFP
UseUnspecifiedTagsExpressionMutationPromoterread throughAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJS010
Plasmid#188333PurposePCR template for repair templates to tag a gene with a mKate2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mKate2::mIAA7
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS004
Plasmid#188327PurposePCR template for repair templates to tag a gene with a mCherry and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mCherry::mIAA7
UseTagsExpressionBacterialMutationPromoterAvailable sinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pENTR-D-TOPO-kcnn2
Plasmid#164958PurposeZebrafish kcnn2 gene CDSDepositorInsertkcnn2 (kcnn2 Zebrafish)
UsePcr cloning vectorTagsExpressionMutationPromoterAvailable sinceMarch 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hygro-10Myc
Plasmid#179814PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xMyc
UseUnspecifiedTagsExpressionMutationPromoterread throughAvailable sinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only