We narrowed to 4,627 results for: pcr
-
Plasmid#179787PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertCLIP
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-hygro-mNG
Plasmid#179819PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJS001
Plasmid#188324PurposePCR template for repair templates to tag a gene with a GFP and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::GFP::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-SNAPtag
Plasmid#179786PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertSNAP
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-HaloTag
Plasmid#181953PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertHaloTag
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMK782 Septin6-GFP
Plasmid#38296DepositorInsertSeptin 6 (Septin6 Mouse)
TagseGFPExpressionMammalianMutation22 amino acid linker sequence (added by PCR)PromoterCMVAvailable SinceNov. 21, 2012AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-10HA
Plasmid#181941PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xHA
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-3HA
Plasmid#221048PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xHA epitopes
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-mScarlet-MCS-polyA
Plasmid#174029PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-mScarlet
UseZebrafish knock-in taggingAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-eGFP-MCS-polyA
Plasmid#174028PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-eGFP
UseZebrafish knock-in taggingAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJJS012
Plasmid#188335PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mTagBFP2::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GBP-kanMX6
Plasmid#89067Purposegenomic GBP epitope C-terminal tagging in S. pombeDepositorTypeEmpty backboneUsePcr-based c-terminal taggingTagsGBPExpressionYeastAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-Venus-PEST-MCS-polyA
Plasmid#174030PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-Venus-PEST
UseZebrafish knock-in taggingAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-nanoluc
Plasmid#179797PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertnanoluc
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-10V5
Plasmid#181938PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xV5
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJJS007
Plasmid#188330PurposePCR template for repair templates to tag a gene with a wrmScarlet and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::wrmScarlet::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-tdTomato-polyA
Plasmid#174027PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-tdTomato
UseZebrafish knock-in taggingAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7.1-phleo-mNG
Plasmid#181935PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only