We narrowed to 4,616 results for: pcr
-
Plasmid#179797PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertnanoluc
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-eGFP-MCS-polyA
Plasmid#174028PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-eGFP
UseZebrafish knock-in taggingAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
M-NM-sgRNA
Plasmid#48673PurposeMammalian U6-driven sgRNA (NMm1) targeting GTCCCCTCCACCCCACAGTGDepositorInsertsgRNA targeting GTCCCCTCCACCCCACAGTG, compatible with N. meningitidis Cas9, hU6 promoter
UseCRISPRPromoterhU6Available SinceOct. 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJJS012
Plasmid#188335PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mTagBFP2::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-10V5
Plasmid#181938PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xV5
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pFA6a-GBP-kanMX6
Plasmid#89067Purposegenomic GBP epitope C-terminal tagging in S. pombeDepositorTypeEmpty backboneUsePcr-based c-terminal taggingTagsGBPExpressionYeastAvailable SinceJune 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-Venus-PEST-MCS-polyA
Plasmid#174030PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-Venus-PEST
UseZebrafish knock-in taggingAvailable SinceSept. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7-blast-10Myc
Plasmid#181939PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert10xMyc
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLO99
Plasmid#90219PurposeComplements mutations in Aspergillus nidulans gene lysB (AN5206) (mutants require lysine)DepositorInsertATET_03691
UseAspergillusPromoterpLacAvailable SinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSCB2-sgRNA
Plasmid#129463PurposeTemplate plasmid for guide sequence insertion via inverse PCR. Derived from pSCrhaB2-gRNA (see paper).DepositorInsertpgRNA
UseCRISPRExpressionBacterialPromoterBBa_J23119 (SpeI)Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPOTv7.1-phleo-mNG
Plasmid#181935PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNG
UseUnspecifiedPromoterread throughAvailable SinceApril 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC19-TgKI-MCS-p2A-tdTomato-polyA
Plasmid#174027PurposeThis plasmid is used for generating C-terminal knock-in plasmid and/or PCR donors in zebrafish.DepositorInsertp2A-tdTomato
UseZebrafish knock-in taggingAvailable SinceNov. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-hygro-His:mNG:His
Plasmid#201096PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJS007
Plasmid#188330PurposePCR template for repair templates to tag a gene with a wrmScarlet and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::wrmScarlet::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPOTv6-blast-His:mNG:His
Plasmid#201094PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsertmNeonGreen
UseUnspecifiedPromoterread throughAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
pPOTv7-blast-3FLAG
Plasmid#221045PurposeTrypanosoma brucei PCR only tagging (pPOT) vector for endogenous gene taggingDepositorInsert3xFLAG epitopes
UseUnspecifiedPromoterread throughAvailable SinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJJS008
Plasmid#188331PurposePCR template for repair templates to tag a gene with a wrmScarlet and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::wrmScarlet::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS011
Plasmid#188334PurposePCR template for repair templates to tag a gene with a mTagBFP2 and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertmIAA7::mTagBFP2::Linker
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJS006
Plasmid#188329PurposePCR template for repair templates to tag a gene with a mNeonGreen and mIAA7 AID degron using homology-directed repair for C. elegans.DepositorInsertLinker::mNeonGreen::mIAA7
ExpressionBacterialAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only