We narrowed to 4,318 results for: AR
-
Plasmid#134543PurposeExpresses YFP-POP5 fusion proteinDepositorInsertPOP5 (POP5 Human)
UseTagsYFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
Sec61 beta pAcGFP-C1 (802)
Plasmid#62008Purposemammalian expression of GFP-Sec61 betaDepositorInsertSec61 beta (SEC61B Human)
UseTagsAcGFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
mito-yHS1-M7A
Plasmid#159164PurposeMitochondrial labile heme reporterDepositorInsertmito-yHS1-M7A
UseTagsCOX4 pre-sequenceExpressionYeastMutationMutated Met 7 of the cyt b562 module of mito-yHS1…PromoterGPDAvailable sinceSept. 21, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pYL236
Plasmid#173184PurposeCRISPR donor plasmid for making the WT EZH2 control cell line. It contains a puromycin resistance gene and an mCherry geneDepositorInsertEZH2 (EZH2 Human)
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pYL214
Plasmid#171031PurposeCRISPR plasmids encodes Cas9 and a sgRNA targeting EZH2 exon 2 - intron 2 junction (sequence: GCAGACGAGCTGATGAAGTAA)DepositorInsertEZH2 (EZH2 Human)
UseCRISPRTagsExpressionMutationPromoterAvailable sinceAug. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEJS1004-pCSDest2-AcrIIA5-NLS-FLAG
Plasmid#136513PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cellsDepositorInsertcodon-optimized AcrIIA5
UseTagsFLAG/NLSExpressionMammalianMutationPromoterCMVAvailable sinceApril 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK0_047
Plasmid#123977PurposeEncodes the Cas9 hCLYBL homology destination with Hygromycin resistance cassette GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInserthCLYBL CAS9 Destination - HygroR
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP-Rpp21-C1
Plasmid#134542PurposeExpresses YFP-Rpp21 fusion proteinDepositorInsertRpp21 (RPP21 Human)
UseTagsYFPExpressionMammalianMutationPromoterCMVAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
MTK0_057
Plasmid#123950PurposeEncodes the hAAVS1 BxBI recognition site with Hygromycin resistance and mRuby2 landing pad with GFP dropout destination vector as a type 0 part to be used in the MTK systemDepositorInsertBxBI LP on hAAVS1 (Hygro::mRuby)
UseTagsExpressionMammalianMutationPromoterAvailable sinceFeb. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
YFP-Rpp14-C1
Plasmid#134540PurposeExpresses YFP-Rpp14 fusion proteinDepositorInsertRpp14 (RPP14 Human)
UseTagsYFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV E2F1 1-284
Plasmid#24216PurposeMammalian expression of human E2F1 (aa 1-284) with HA tagDepositorInsertE2F1 1-284 (E2F1 Human)
UseTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2011AvailabilityAcademic Institutions and Nonprofits only -
WFS1 pEGFP-N2 (1472)
Plasmid#62051Purposemammalian expression of nuclear envelope transmembrane proteinDepositorInsertWFS1 (WFS1 Human)
UseTagsEGFPExpressionMammalianMutationPromoterCMVAvailable sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
MTK0_017
Plasmid#123932PurposeEncodes the BxBI attB GFP dropout destination vector constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertBxBI attB tagBFP destination vector
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK0_015
Plasmid#123930PurposeEncodes the piggyBac GFP dropout destination vector with the 2xHS4 insulator and constitutive NLS::tagBFP as a type 0 part to be used in the MTK systemDepositorInsertPB Destination - Insulator + tagBFP
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_009
Plasmid#123724PurposeEncodes nuclear localized PHYB fused to activating domain of VP16 as Type 3 part to be used in the MTK systemDepositorInsertPHYB-VP16-NLS
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
YFP-Rpp40-C1
Plasmid#134549PurposeExpresses YFP-Rpp40 fusion proteinDepositorInsertRpp40 (RPP40 Human)
UseTagsYFPExpressionMammalianMutationPromoterCMVAvailable sinceMarch 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIRESpuro-Flag-Pol b(K72A)
Plasmid#23258DepositorInsertDNA polymerase beta (K72A) (POLB Human)
UseTagsFlagExpressionMammalianMutationK72APromoterAvailable sinceMarch 31, 2010AvailabilityAcademic Institutions and Nonprofits only -
pEJS1026-pMCSG7-HpaCas9
Plasmid#121540PurposeExpresses a 6X-His tagged type II-C Cas9 from H. parainfluenzae in bacterial cellsDepositorInsertHpaCas9
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pEJS1027-pMCSG7-SmuCas9
Plasmid#121541PurposeExpresses a 6X-His tagged type II-C Cas9 from S. muelleri in bacterial cellsDepositorInsertSmuCas9
UseTagsExpressionBacterialMutationPromoterAvailable sinceFeb. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK3_020
Plasmid#123735PurposeEncodes rapamycin and tamoxifen activated split-dCAS9 (C-terminal) as a Type 3 part to be used in the MTK systemDepositorInsertERT2-fkbp-spdCa9(205-1368)
UseTagsExpressionMammalianMutationPromoterAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only