-
Plasmid#183874PurposepX459V2.0-HypaCas9 plasmid with ANLN sgRNA for N-terminal tagging of anillin in human cells.DepositorInsertANLN sgRNA spacer (ANLN Human)
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMay 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
ULK1 gRNA (BRDN0001145850)
Plasmid#75737Purpose3rd generation lentiviral gRNA plasmid targeting human ULK1DepositorInsertULK1 (ULK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK2 gRNA (BRDN0001146342)
Plasmid#75637Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK2DepositorInsertEIF2AK2 (EIF2AK2 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pegRNA-HEK3_del1-5-NGG
Plasmid#185478PurposepegRNA plasmid in order to make a 5 basepair deletion at the HEK3 locus, uses an NGG-PAM site.DepositorInsertHEK3_del1-5-NGG pegRNA
UseTagsExpressionMammalianMutationPromoterU6Available sinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
SP6-sgRNA-scaffold
Plasmid#47912PurposeScaffold into which clone a 20 bp targeting sequence to generate a plasmid for in vitro transcription of an sgRNA using SP6 RNA polymerase for use in CRISPR-Cas by RNA injectionDepositorTypeEmpty backboneUseCRISPRTagssgRNA 3' endExpressionWormMutationPromoterSP6Available sinceSept. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001148392)
Plasmid#76362Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorInsertTBK1 (TBK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RRM1 E1.3 gRNA
Plasmid#90880Purpose3rd generation lentiviral gRNA plasmid targeting human RRM1DepositorInsertRRM1 (Guide Designation E1.3)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pX330_Actb sgRNA / hSpCas9
Plasmid#172832PurposeMammalian expression of a sgRNA targeting the intron 1of Actb (Zhong et al, eLife 2021) under the U6 promotor and hSpCas9 under the CAG promotor. This construct is based on pX330.DepositorInsertsgRNA targeting intron 1 of Actb under the U6 promotor and hSpCas9 under the CAG promotor
UseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceAug. 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
CHEK2 C3.2 gRNA
Plasmid#90628Purpose3rd generation lentiviral gRNA plasmid targeting human CHEK2DepositorInsertCHEK2 (Guide Designation C3.2)
UseCRISPR and LentiviralTagsExpressionMutationPromoterU6Available sinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV/eGFP-U6-sgRNA
Plasmid#170544PurposeA lentiviral backbone for homology directed insertion of eGFP. Containing only eGFP, flanked by restriction sites for insertion of homology arms and a sgRNA casstte to clone in sgRNA for HDRDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceJan. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Skil-gRNA2
Plasmid#180371Purposetargeting mouse Skil/SnoN geneDepositorInsertSkil targeting gRNA (Skil Mouse)
UseRetroviralTagsExpressionMammalianMutationPromoterhuman U6Available sinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCfB3052(gRNA X-4, XI-3, XII-5)
Plasmid#73294PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-4, XI-3, and XII-5DepositorInsertguiding RNA
UseCRISPR; GrnaTagsExpressionYeastMutationPromoterAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
Spy EMX1-pegRNA
Plasmid#169855PurposeSpyCas9-pegRNA for EMX1DepositorInsertSpy EMX1-pegRNA
UseTagsExpressionMammalianMutationPromoterhuman U6 promoterAvailable sinceJune 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ABE-NT-sgRNA
Plasmid#112734PurposeAAV inverted terminal repeat based vector plasmid encoding E. coli TadA, the N-terminal half of nCas9 and sgRNADepositorInsertABE-NT-sgRNA
UseAAVTagsExpressionMutationPromoterAvailable sinceJuly 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001144730)
Plasmid#77980Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorInsertPGK1 (PGK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EIF2AK1 gRNA (BRDN0001162423)
Plasmid#77048Purpose3rd generation lentiviral gRNA plasmid targeting human EIF2AK1DepositorInsertEIF2AK1 (EIF2AK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMA-MsgRNA-EGFP
Plasmid#80794PurposeFor insertion of gRNA array containing 11-30 gRNA modulesDepositorTypeEmpty backboneUseCRISPRTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
TBK1 gRNA (BRDN0001145663)
Plasmid#76361Purpose3rd generation lentiviral gRNA plasmid targeting human TBK1DepositorInsertTBK1 (TBK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
UseTagsExpressionMammalianMutationPromoterCMV and U6Available sinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
PGK1 gRNA (BRDN0001487049)
Plasmid#77981Purpose3rd generation lentiviral gRNA plasmid targeting human PGK1DepositorInsertPGK1 (PGK1 Human)
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only