We narrowed to 14,484 results for: SHR;
-
Plasmid#106948PurposesgRNA cloning cassette using BsmBI/Esp3I enzymes with GFP markerDepositorInsertsgRNA BsmBI/Esp3I cloning site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-AsCas12a_crRNA-site4 (MSP3511)
Plasmid#160139PurposeT7 promoter expression plasmid for in vitro transcription of AsCas12a crRNA with spacer #4DepositorInsertAsCas12a crRNA with spacer #4 (spacer=GGAATCCCTTCTGCAGCACCTGG)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTX209
Plasmid#89269PurposeExpress STU Cas9 with Maize Ubiquitin1 promoter in rice targeting OsPDS gene, OsPDS-gRNA01 and OsPDS-gRNA02DepositorInsertOsPDS-gRNA01 and OsPDS-gRNA02
UseCRISPRTagsSV40 NLSExpressionPlantPromoterMaize Ubiquitin1 promoterAvailable SinceMay 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
BC1441-mouse U6-3xsgRNAs (TS5, TS6, TS7)
Plasmid#164040PurposeExpression of three sgRNAs (sgTS5, sgTS6, sgTS7) for targeting to CRISPR-Tag_V2DepositorInsertsgTS5-sgTS6-sgTS7
UseCRISPRPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
SL2-sgTelo-MTSa/BFP/pdCas9-C1
Plasmid#162760PurposeExpressing dCas9 and sgRNA containg MTSa targeting telomeresDepositorInsertdCas9 and sgRNA(SL2-sgTelo-MTSa)
ExpressionMammalianMutationdCas9(nuclease deactivated Cas9)PromoterU6/CMVAvailable SinceJan. 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pX459-sg-mGreenLantern/EGFP
Plasmid#179913PurposeAll in one Cas9 plasmid with puromycin resistance and a single guide RNA targeting mGreenLantern and EGFP fluorescent proteins.DepositorInsertmGreenLantern/EGFP sgRNA
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianPromoterU6Available SinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pUD628
Plasmid#103018Purposeexpression of a Cpf1 programming crRNA targetting ADE2 (crADE2-3.S)DepositorAvailable SinceDec. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
Pb459-mU6-sgRNA-EF1a-PuroR
Plasmid#195507Purposepiggybac vector expressing non-targeting control sgRNA cloned using BlpI and BstXI sitesDepositorInsertPuromycin
UseCRISPR; PiggybacExpressionMammalianAvailable SinceFeb. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
px330-UFL1 sgRNA2
Plasmid#134636Purposecontains sgRNA targeting human UFL1 for gene knockoutDepositorInsertUFL1 sgRNA2 (UFL1 Human)
ExpressionMammalianAvailable SinceNov. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
GEARBOCS-SPARCL1-C-mCherryTag
Plasmid#218183PurposeTo tag Hevin with mCherry at its C-terminalDepositorInsertsgRNA (Sparcl1 Mouse)
UseAAV and CRISPRAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only