We narrowed to 14,484 results for: SHR;
-
Plasmid#11774DepositorAvailable SinceFeb. 15, 2007AvailabilityAcademic Institutions and Nonprofits only
-
pCfB3041(gRNA X-3)
Plasmid#73283PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site X-3DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJMP1239
Plasmid#119263Purposeknockdown folA in P. aeruginosaDepositorInsertsgRNA folA (P. aeruginosa)
ExpressionBacterialMutationD10A and H840AAvailable SinceJan. 7, 2019AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR V2 sgMTFMT_1
Plasmid#106318PurposeExpress Cas9 and sgRNA targeting MTFMTDepositorInsertsgRNA targeting MTFMT
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCfB3047(gRNA XII-1)
Plasmid#73289PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at site XII-1DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
PGL3-U6-RNF2_pegRNA-Csy4RS-nick_sgRNA-EGFP
Plasmid#172669PurposeFor expression of transcript containing pegRNA and nick-sgRNA targeting human RNF2 gene from the U6 promoter with pegRNA flanked by Csy4 recognition siteDepositorInsertRNF2 pegRNA and RNF2_nick-sgRNA
ExpressionMammalianPromoterU6Available SinceAug. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSMP-MBD2_1
Plasmid#36368DepositorAvailable SinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR sgSLC19A1
Plasmid#102314Purposegenetic depletion of SLC19A1DepositorAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKDsgRNA-ldhA
Plasmid#102288PurposeContains arabinose-induced lambda Red and a tet-inducible gRNA targeting ldhA.DepositorInsertldhA gRNA
UseCRISPRExpressionBacterialPromoterpTetAvailable SinceApril 12, 2018AvailabilityAcademic Institutions and Nonprofits only