We narrowed to 7,358 results for: Ank
-
Plasmid#80064PurposeZic2a promoter driving HA-tagged biotin ligase (BirA), a Thosea asigna virus peptide (2A), and membrane-tethered mCherry protein (membCherry); flanked by Tol2 sequencesDepositorInsertBiotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
UseZebrafish biotaggingTags3x HAExpressionBacterialPromoterZic2a enhancer driving c-fos promoterAvailable SinceOct. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1 ObLiGaRe Donor vector/EPB58
Plasmid#90016PurposeDonor vector for ObLiGaRe/ZFN mediated targeting to AAVS1 locusDepositorInsertMCS flanked by inverted ZFN binding sites (PPP1R12C Human)
ExpressionBacterialAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau7-12WT
Plasmid#194166PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 7,9-12. Expresses the tau circRNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertMicrotubule-associated protein tau 7-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12WT
Plasmid#194163PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by the wild-type tau cDNA exons 10-12. Expresses the tau circRNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT ZKSCAN1 intronic alu elements
Tags3X flag tagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUPD2 PhiC31 attP:TMtb:P35S:attB (GB1494)
Plasmid#160577Purpose35S promoter sequence and the Mtb terminator flanked by two opposing PhiC31 site-specific recombination sites (attP and attB)DepositorInsertPhiC31 PB (attP:TMtb:P35S:attB)
UseSynthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceJan. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
TVBB C-term-Dendra2
Plasmid#169216PurposeTargeting vector backbone to support a knock-in of Linker-Dendra2 at the C-terminus of a target locusDepositorInsertDouble SapI flanked Dendra2-P2A-Puro
UseTargeting vector backboneAvailable SinceJan. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
C-His-GvpC-Calpain
Plasmid#153295PurposeExpresses calpain-sensitive variant of Anabaena flos-aquae GvpC in E.coliDepositorInsertCalpain-sensitive Gas vesicle protein C (his-tagged)
TagsHis-tagExpressionBacterialMutation1) Contains an extra glycine after the methionine…PromoterT7Available SinceSept. 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001146403)
Plasmid#76373Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK32B gRNA (BRDN0001145394)
Plasmid#76374Purpose3rd generation lentiviral gRNA plasmid targeting human STK32BDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only