We narrowed to 7,309 results for: aav
-
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-ArgiNLS-EGFP
Plasmid#220601PurposeCre-dependent expression of a single-cell discriminating version of EGFP fluorescent proteinDepositorInsertEGFP
UseAAV and Cre/LoxTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Hbb
Plasmid#99693PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Hbb promoter, vector allows for activation of mouse Hbb, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Hbb (gRNA: GGGGTAAGGGGAGCAAGGTC) (Hbb Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GCaMP6f-WPRE
Plasmid#216275PurposeAAV vector with hSynapsin promoter and DIO Lox sites for Cre-On expression of green fluorescent calcium indicator GCaMP6fDepositorInsertGCaMP6f
UseAAV and Cre/LoxTags6XHIS and XpressPromoterhuman Synapsin 1 (hSyn)Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMV2 AAV-RapaInducible-NFZ-HGF
Plasmid#188749PurposeRapamycin inducible AAV vector expressing HGFDepositorAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT314 AAV-Rapamycin Inducible-NZ-Citrine
Plasmid#202063PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-NZ-Citrine
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT365 AAV-Rapamycin Inducible-S3H
Plasmid#202066PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-S3H
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT366 AAV-Rapamycin Inducible QNZF
Plasmid#202067PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible QNZF
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT313 AAV-Rapamycin Inducible-ZF-Citrine
Plasmid#202062PurposeInducible AAV activatorDepositorInsertAAV-Rapamycin Inducible-ZF-Citrine
UseAAV; Aav with reporterExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-K-red-SPOTIT(R271F)
Plasmid#191494PurposeRed fluorescent-based opioid sensor for the kappa opioid receptor with reduced Gai coupling in AAV viral vector under a CAG promoterDepositorInsertK-red-SPOTIT(R271F)
UseAAVMutationR271F in ORPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-CAG-M-red-SPOTIT2(R279F)
Plasmid#191495PurposeRed fluorescent-based opioid sensor for the mu opioid receptor with reduced Gai coupling in AAV viral vector under a CAG promoterDepositorInsertM-red-SPOTIT2(R279F)
UseAAVMutationR279F in ORPromoterCAGAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgFAAH
Plasmid#209197PurposeMutagenesis of FaahDepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgKcnma1
Plasmid#209199PurposeMutagenesis of Kcnma1DepositorAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-GRAB_g5-HT2h
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Best1-nt.Txnip(C247S)(1-320aa)
Plasmid#206352PurposeAAV plasmid expressing deltion and mutant TXNIP in retinal pigment epitheliumDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Best1-C.Txnip(C247S_LL351-352AA)
Plasmid#206350PurposeAAV plasmid expressing deltion and mutant TXNIP in retinal pigment epitheliumDepositorInsertTxnip (Txnip Mouse)
UseAAVMutationC terminal half (149-397aa), C247S and LL351&…Promoterhuman Best1Available SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-Best1-Txnip(C247S_LL351-352AA)
Plasmid#206344PurposeAAV plasmid expressing mutant TXNIP in retinal pigment epitheliumDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RedO-nt.Txnip(C247S)(1-301aa)
Plasmid#206354PurposeAAV plasmid expressing deltion and mutant TXNIP in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hPhyB621(Y276H)-P2A-m1V
Plasmid#197377PurposeThe AAV vector for PhyB621(Y276H) and m1VDepositorInsertPhytochrome B Y276H(1-621 aa)
UseAAVTagsP2A-m1VMutationHuman codon optimized PhyB (1-621 aa), Y276H muta…PromoterCMVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb713-P2A-GFP
Plasmid#197172PurposeExpresses the protein of mRhubarb713-P2A-GFP in mammalian cellsDepositorInsertmRhubard713-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP2-P2A-GFP
Plasmid#197155PurposeExpresses the protein of miRFP2-P2A-GFP in mammalian cellsDepositorInsertmiRFP2-P2A-GFP
UseAAVAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-ef1a-DIO-eGCaMP(plus)
Plasmid#201149PurposeAAV virus production for Cre recombinase dependent expression of eGCaMP(plus)DepositorInserteGCaMP+
UseAAV, Cre/Lox, and Mouse TargetingExpressionMammalianAvailable SinceJune 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-sgRNA(OXTR.2)-CMV-eGFP
Plasmid#194016PurposeExpresses a gRNA that targets OXTR coding sequence in multiple (rodent) species and eGFPDepositorInsertssgRNA(Oxtr.2)
eGFP
UseAAV and CRISPRExpressionMammalianPromotercmb and u6Available SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1
Plasmid#190902PurposeAAV vector expressing thew GFP reporter gene and human sgHTTDepositorAvailable SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-alphaCaMKII-dsRed-Express-3XNLS-pA
Plasmid#183802PurposeAAV vector to express nuclear localized dsRed-Express from CaMKIIa promoterDepositorInsertdsRed-Express
UseAAVTagsNLSAvailable SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-miRFP670-2-P2A-GFP
Plasmid#197170PurposeExpresses the protein of miRFP670-2-P2A-GFP in mammalian cellsDepositorInsertmiRFP670-2-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP670-P2A-GFP
Plasmid#197169PurposeExpresses the protein of iRFP670-P2A-GFP in mammalian cellsDepositorInsertiRFP670-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mCardinal-P2A-GFP
Plasmid#197167PurposeExpresses the protein of mCardinal-P2A-GFP in mammalian cellsDepositorInsertmCardinal-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-iRFP713-P2A-GFP
Plasmid#197166PurposeExpresses the protein of iRFP713-P2A-GFP in mammalian cellsDepositorInsertiRFP713-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-E2-Crimson-P2A-GFP
Plasmid#197162PurposeExpresses the protein of E2-Crimson-P2A-GFP in mammalian cellsDepositorInsertE2-Crimson-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-emiRFP703-P2A-GFP
Plasmid#197158PurposeExpresses the protein of emiRFP703-P2A-GFP in mammalian cellsDepositorInsertemiRFP703-P2A-GFP
UseAAVAvailable SinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-IFP2-P2A-GFP
Plasmid#197161PurposeExpresses the protein of IFP2-P2A-GFP in mammalian cellsDepositorInsertIFP2-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb720-P2A-GFP
Plasmid#197159PurposeExpresses the protein of mRhubarb720-P2A-GFP in mammalian cellsDepositorInsertmRhubarb720-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BDFP1.6-P2A-GFP
Plasmid#197154PurposeExpresses the protein of BDFP1.6-P2A-GFP in mammalian cellsDepositorInsertBDFP1.6-P2A-GFP
UseAAVAvailable SinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-mRhubarb719-P2A-GFP
Plasmid#197152PurposeExpresses the protein of mRhubarb719-P2A-GFP in mammalian cellsDepositorInsertmRhubarb719-P2A-GFP
UseAAVAvailable SinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-myc-C3
Plasmid#129478PurposeAAV2 transfer plasmid for myc-tagged C3 with EGFP under control of the CBA promoterDepositorInsertMyc-tagged (N-terminus) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CBA::EGFP-P2A-tC3
Plasmid#129476PurposeAAV2 transfer plasmid for truncated C3 with EGFP under control of the CBA promoterDepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseAAVExpressionMammalianPromoterCBAAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4a
Plasmid#194973PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4a) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4d
Plasmid#194975PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4d) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_P1
Plasmid#194972PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform P1) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mScarlet-Gphn_C4c
Plasmid#194974PurposeAAV vector to drive the Flp-dependent expression of mScarlet-Gphn (isoform C4c) under the control of human Synapsin promoterDepositorAvailable SinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOttc1494 - pAAV CaMKII SERCaMP-No Tag
Plasmid#192601PurposeAn AAV packaging vector that expresses SERCaMP under control of the CaMKII promoter.DepositorInsertSERCaMP
UseAAVPromoterCaMKIIAvailable SinceJan. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV2/9-shMBVR-HO1-Fd-Fnr-CW3SL
Plasmid#184003PurposeAAV productionDepositorInsertshMBVR-HO1-Fd-Fnr-CW3SL
UseAAVAvailable SinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV_pMBP-dnVamp3-P2AT2A-EGFP-caax
Plasmid#190154PurposeExpresses dominant-negative Vamp3 (rat Vamp3 AA 1-81) plus membrane-targeted EGFP in oligodendrocytes; AAV vectorDepositorInsertVamp3 (Vamp2 Rat)
UseAAVTagsP2AT2A-EGFP-caaxExpressionMammalianMutationTruncation that includes only rat Vamp3 AA #1-81PromoterMBPAvailable SinceDec. 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-LifeAct-jGCaMP8f-WPRE
Plasmid#186038PurposeAAV-mediated expression of LifeAct-jGCaMP8f under the synapsin promoterDepositorInsertLifeAct-jGCaMP8f
UseAAVTagsLifeAct-6xHisExpressionMammalianPromotersynapsinAvailable SinceAug. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-syn-LifeAct-jGCaMP8s-WPRE
Plasmid#186040PurposeAAV-mediated expression of LifeAct-jGCaMP8s under the synapsin promoterDepositorInsertLifeAct-jGCaMP8s
UseAAVTagsLifeAct-6xHisExpressionMammalianPromotersynapsinAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-fDIO-tdTomato-WPRE
Plasmid#187112PurposeFLP-dependent expression of tdTomato under EF1a promoterDepositorInserttdTomato
UseAAVAvailable SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only