We narrowed to 19,813 results for: INO
-
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBullet-cg-c
Plasmid#53070Purposedestination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant geneDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceJuly 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
ptdTomato-N1-CMVL-ikk1FL(C179A)-tdTomato
Plasmid#105644PurposeZebrafish Inhibitor of kappa B kinase alpha with mutation at position 179 from cysteine to alanineDepositorInsertCMVL-ikk1FL(C179A)-tdTomato (chuk Zebrafish)
TagstdTomatoExpressionMammalianMutationCMV:ikk1FL(C178A)-tdTomatoAvailable SinceFeb. 5, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRC/RSV-rat Agt
Plasmid#122104PurposeExpression of angiotensinogenDepositorAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
3xNLS-NLP-cMyc-cMyc AspCas12a
Plasmid#182122PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc AspCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc AspCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(hPLK1)-PGKpuro2ABFP-W
Plasmid#163138PurposeLentiviral gRNA plasmid targeting human PLK1 gene, co-expression of BFP tagDepositorAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag4A-MMP8 (P78S)
Plasmid#29546DepositorInsertMetalloproteinase protein 8 (MMP8 Human)
TagsFLAGExpressionBacterial and MammalianMutationP78SAvailable SinceJuly 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-T338M-V5
Plasmid#167470Purposeectopic expression of hDDB2 in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGL3-DICER-Prom Ebox double mut
Plasmid#25854DepositorInsertDICER-Promoter Ebox double mut (DICER1 gene ID 23405, Human)
UseLuciferaseExpressionMammalianAvailable SinceAug. 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-hDDB2-K244E-V5
Plasmid#167471Purposeectopic expression of hDDB2 in mammalian cellsDepositorAvailable SinceApril 21, 2021AvailabilityAcademic Institutions and Nonprofits only