We narrowed to 23,248 results for: crispr
-
Plasmid#90790Purpose3rd generation lentiviral gRNA plasmid targeting human NDEL1DepositorInsertNDEL1 (Guide Designation F3.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
PPP2R5E C1.5 gRNA
Plasmid#90855Purpose3rd generation lentiviral gRNA plasmid targeting human PPP2R5EDepositorInsertPPP2R5E (Guide Designation C1.5)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 25, 2017AvailabilityAcademic Institutions and Nonprofits only -
TPX2 H2.2 gRNA
Plasmid#90919Purpose3rd generation lentiviral gRNA plasmid targeting human TPX2DepositorInsertTPX2 (Guide Designation H2.2)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E12.3 gRNA
Plasmid#90645Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E12.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
CTPS1 E11.3 gRNA
Plasmid#90644Purpose3rd generation lentiviral gRNA plasmid targeting human CTPS1DepositorInsertCTPS1 (Guide Designation E11.3)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
FBXO5 D4.4 gRNA
Plasmid#90687Purpose3rd generation lentiviral gRNA plasmid targeting human FBXO5DepositorInsertFBXO5 (Guide Designation D4.4)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F1.1 gRNA
Plasmid#90744Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F1.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
MAD2L1BP F2.1 gRNA
Plasmid#90745Purpose3rd generation lentiviral gRNA plasmid targeting human MAD2L1BPDepositorInsertMAD2L1BP (Guide Designation F2.1)
UseCRISPR and LentiviralPromoterU6Available SinceJuly 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
p305N-31 (nonfunctional)
Plasmid#246314PurposeEvaluation of PtU6.2c4 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertPtU6.2c4 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationdeletions: -A (-41 from TSS), -T (-30), -T (-29);…PromoterPtU6.2c4 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-9 (nonfunctional)
Plasmid#246292PurposeEvaluation of AtU6.29c13 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.29c13 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationdeletions: -A (-58 from TSS), -T (-57) within USEPromoterAtU6.29c13 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-17 (nonfunctional)
Plasmid#246300PurposeEvaluation of HbU6.2m3 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m3 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-T (-29 from TSS), G-to-A (-24)PromoterHbU6.2m3 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-26 (nonfunctional)
Plasmid#246309PurposeEvaluation of MtU6.6m7 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertMtU6.6m7 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationC-to-A (-63 from TSS), T-to-G (-57)PromoterMtU6.6m7 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLP857_α-syn:oScarlet KI donor
Plasmid#239403PurposeAAV vector for SpCas9-mediated CRISPR KI of oScarlet at the C-terminus of mouse α-synDepositorInsertoScarlet
UseAAV and CRISPRTagsoScarletExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM2_Euk_2NLS-RVQ (LbCas12a)-2NLS
Plasmid#244837PurposeMammalian expression of LbCas12a-RVQ with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a-RVQ
UseCRISPRTags2xSV40 NLSExpressionMammalianMutationG146R/R182V/E795QPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pEM1_Euk_2NLS-WT ( LbCas12a)-2NLS
Plasmid#244836PurposeMammalian expression of wild-type LbCas12a with 2xSV40 NLS at N-terminus and 2xSV40 at C-terminusDepositorInsertLbCas12a
UseCRISPRTags2xSV40 NLSExpressionMammalianPromoterT7Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kh
Plasmid#160297PurposeYeast CRISPR plasmid targeting the kanMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceSept. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMKR07
Plasmid#240097PurposeA CRISPR‑Cas9 system for knock‑out and knock‑in of high molecular weight DNA enables module‑swapping of the pikromycin synthase in its native hostDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionBacterialPromoterermE* promoterAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT44
Plasmid#223416PurposeT-DNA vector for temperature tolerance LbCas12a-D156R based mutagenesis for monocot plants; TTTV PAM; LbCas12a-D156R and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-LbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT47
Plasmid#223419PurposeT-DNA vector for Mb2Cas12a-RVRR based mutagenesis for monocot plants; more relaxed PAM requirements; Mb2Cas12a-RVRR and the crRNA were driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-Mb2Cas12a-RVRR-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT48
Plasmid#223420PurposeT-DNA vector for Mb2Cas12a-RVRR based mutagenesis for dicot plants; more relaxed PAM requirements; Mb2Cas12a-RVRR and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-Mb2Cas12a-RVRR-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT49
Plasmid#223421PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT50
Plasmid#223422PurposeT-DNA vector for LbCas12a-RRV based mutagenesis for monocot plants; highly efficient including TTV PAM; LbCas12a-RRV and the crRNA was driven by separate ZmUbi1 promoter; Hygromycin for plants select.DepositorInsertZmUbi-LbCas12a-RRV-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT52
Plasmid#223424PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT53
Plasmid#223425PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-dLbCas12a-D156R-ZmUbi-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT54
Plasmid#223426PurposeT-DNA vector for dLbCas12a-D156R mediated A to G base editing for monocot plants; TTTV PAM; LbCas12a-D156R-ABE and the crRNA were driven by separate 2x35s promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-dLbCas12a-D156R-2x35s-crRNA scaffold
UseCRISPRTagsNLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT33
Plasmid#223405PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for dicot plants; NGG PAM; SpCas9D10A-ABE was driven by 2x35s and the sgRNA was driven by AtU3 promoter; Kanamycin for plants selection.DepositorInsert2x35s-ecTadA8e-SpCas9-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT34
Plasmid#223406PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT35
Plasmid#223407PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT36
Plasmid#223408PurposeT-DNA vector for SpCas9-D10A based A-to-G base editing for monocot plants; NGG PAM; SpCas9D10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpCas9-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1nh
Plasmid#160299PurposeYeast CRISPR plasmid targeting the natMX and hphMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5.1kn
Plasmid#160298PurposeYeast CRISPR plasmid targeting the kanMX and natMX cassettesDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3MX selection cassette
sgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Kan
Plasmid#232096PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p223-Pulse-Switch
Plasmid#217889PurposeLentiviral Pulse-Switch vector for sgRNA expression, Cas9 and sgRNA expression are mutual exclusive; blastiRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and LentiviralExpressionMammalianPromoterhU6Available SinceMay 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEL667
Plasmid#196815PurposeLrCas9 genome editing plasmid in wheatDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbiAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL668
Plasmid#196816PurposeLrCas9 genome editing plasmid in larixDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterLrk004PAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEL669
Plasmid#196817PurposeLrCas9 genome editing plasmid in tomatoDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionPlantPromoterSlEF1aAvailable SinceOct. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG-AaCas12b(Q119F/E475R/E758R)-T2A-EGFP
Plasmid#188272PurposeMammalian expression, Genome editingDepositorInsertAaCas12b(Q119F/E475R/E758R)
UseCRISPRExpressionMammalianMutationnonePromoterCAGAvailable SinceJuly 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBBK54 pHomL-RPL18Bp-Neon(gfp)-Link-2xPH(PLCd)-SSA1t-HomR (AmpR)
Plasmid#179038PurposeVector containing a yeast integration cassette for RPL18B-driven expression of Neon(gfp)-Link-2xPH(PLCd), a marker for the plasma membraneDepositorInsertRPL18Bp-Neon(gfp)-Link-2xPH(PLCd)
ExpressionYeastAvailable SinceMay 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
SaCas9-mSA
Plasmid#182953PurposeExpress SaCas9-mSADepositorInsertSaCas9-mSA
UseCRISPRExpressionMammalianAvailable SinceApril 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
1098E=TI-pgSIT[tra,bTub,Hasp70Bb-Cas9]
Plasmid#149427PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes, and Hsp70Bb-Cas9-T2A-eGFP-p10.DepositorInsertsU6.3-gRNAs[TraB, bTub]
Hsp70Bb-Cas9-T2A-eGFP-p10
UseCRISPRTagseGFPExpressionInsectAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVMG0193_Cq-Rpl40-Cas9
Plasmid#169346PurposeExpression of Cas9 in Culex quinquefasciatus or other mosquitoesDepositorInsertpVMG0193_Cq-Rpl40-Cas9
UseCRISPRExpressionInsectPromoterCPIJ002413Available SinceMay 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEL052
Plasmid#137906PurposeOsBiP1 promoter driven Cas9-tRNA systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL053
Plasmid#137907PurposeOsBiP1 promoter driven Cas9-csy4 systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pUC19-hsg(G:H)
Plasmid#138259PurposeExpression of humanized mCherry-targeting sgRNAs to the left (G) and right (H) of iCas9 recognition sequences to be used in Traffic Light reporter systemDepositorInsertmCherry targeting sgRNAs G and H
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL050
Plasmid#137904PurposeDual-mini35S driven Cas9-Csy4 systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL051
Plasmid#137905PurposeDual-mini35S-enhancer driven Cas9-Csy4 systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceFeb. 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_MAF1_iso1_2
Plasmid#135750PurposeEncodes gRNA for 3' target of human MAF1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ELK1_iso1_1
Plasmid#135757PurposeEncodes gRNA for 3' target of human ELK1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_ELK1_iso1_2
Plasmid#135758PurposeEncodes gRNA for 3' target of human ELK1_iso1DepositorAvailable SinceJan. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
PX330_E2F4_iso1_1
Plasmid#135756PurposeEncodes gRNA for 3' target of human E2F4_iso1DepositorAvailable SinceJan. 24, 2020AvailabilityAcademic Institutions and Nonprofits only