We narrowed to 1,520 results for: tetracycline
-
Plasmid#245878PurposeGolden gate entry vector carrying the 2nd gRNA for base editing in Carrizo citrange ALS gene along with TLS mobile RNA sequenceDepositorInsertCsALSgR1.2
UseCRISPR; Golden gate entry vectorExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B-CsALSgR1.1
Plasmid#245875PurposeGolden gate entry vector carrying the 1st gRNA for base editing in Carrizo citrange ALS geneDepositorInsertCsALS_gRNA1.1
UseCRISPR; Golden gate entry vector to expressing t…ExpressionPlantPromoterAtU3Available SinceFeb. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
AAV-TRE-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177344PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from doxycycine-inducible promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterTetracycline-dependent promotersAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131-RZ-Cas12j2
Plasmid#189782PurposeGolden Gate entry vector to clone the 1st Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132-RZ-Cas12j2
Plasmid#189783PurposeGolden Gate entry vector to clone the 2nd Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-RZ-Cas12j2
Plasmid#189785PurposeGolden Gate entry vector to clone the 4th Cas12j2(CasΦ) crRNA flanked by HH and HDV ribozymesDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMH011_AAVS1_puro-pA-9xTetO-pEF-H2B-mCitrine-HS4-pRSV-H2B-mCherry
Plasmid#179434PurposeDual fluorescent reporter construct with single HS4 insulator, upstream TRE (Tetracycline Response Element) recruitment site, arms for integration at AAVS1 locusDepositorInsertTRE-cit-HS4-mch (SH)
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceMarch 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCSJ982
Plasmid#176622PurposeExpress yeast Ub-MPGLW-Fbp1-3xflag and reference flag-DHFR-ha protein, both are contolled by tetracycline mediated TDH promter, test protein expression and stability.DepositorInsertUb-MPGLW-Fbp1
TagsUbiquitin N-terminal fusion and triple flag tag C…ExpressionYeastMutationChanged first 4 N-terminal amino acid residues of…PromoterTDH3tc3Available SinceMarch 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSL006_phiC31_neo-5xTetO-pEF-H2B-mCitrine-pRSV-H2B-mCherry
Plasmid#179425PurposeDual fluorescent reporter construct with no spacer, upstream TRE (Tetracycline Response Element) recruitment site, phiC31 attB for integrationDepositorInsertTRE-cit-(nospacer)-mch
ExpressionMammalianPromoterpEF alpha, pRSVAvailable SinceFeb. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-FRT-TO-Nprot_GC3opt
Plasmid#157730Purposemammalian expression of untagged SARS-CoV-2 N protein under control of a tetracycline-inducible promoterDepositorInsertNprot_GC3opt (N SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 6, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-Nsp8_GC3opt
Plasmid#157697Purposemammalian expression of untagged SARS-CoV-2 Nsp8 under control of a tetracycline-inducible promoterDepositorInsertNsp8_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA-FRT-TO-Nsp8-Nsp7_GC3opt
Plasmid#157700Purposemammalian expression of untagged SARS-CoV-2 Nsp8-Nsp7 fusion protein under control of a tetracycline-inducible promoterDepositorInsertNsp8-Nsp7_GC3opt (ORF1ab SARS-CoV-2)
ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pcDNA5-FRT-TO-FH-Nsp8_GC3opt
Plasmid#157698Purposemammalian expression of N-terminally Flag-His8 tagged SARS-CoV-2 Nsp8 under control of a tetracycline-inducible promoterDepositorInsertFH-Nsp8_GC3opt (ORF1ab SARS-CoV-2)
TagsFlag-His8ExpressionMammalianMutationcodon optimized; gene expression was optimized by…Available SinceAug. 5, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pIND21-puro_SOX10-3xFLAG
Plasmid#250322PurposeTetracycline-inducible expression of SOX10. rtTA (Tet-ON) is driven by the EF1alpha promoter.DepositorAvailable SinceFeb. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pinducer 20 DN-KASH
Plasmid#125554PurposeTet-ON inducible lentivirus expressing mcherry-labeled DN KASHDepositorInsertSYNE1 (SYNE1 Human)
UseLentiviralTagsmcherryMutationTruncated form: only the KASH domain of nesprin-…Promotertetracycline responsive elementAvailable SinceJuly 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEW100v5-BSD-FLAG-La-Cas9
Plasmid#245102PurposeInserts tetracycline-inducible codon optimized, nuclceus targeted FLAG-Cas9 into T. brucei cells at the rDNA spacerDepositorInsert3xFLAG-La-Cas9
UseCRISPRTags3xFLAG-LaMutationcodon optimized for T. bruceiAvailable SinceApril 8, 2026AvailabilityAcademic Institutions and Nonprofits only -
FUW TetO HA-AMPKa1 WT
Plasmid#69824PurposeExpresses AMPK alpha 1 in mammalian cells in a doxycycline inducible mannerDepositorInsert5'-AMP-activated protein kinase catalytic subunit alpha-1 (PRKAA1 Human)
UseLentiviralTagsHAExpressionMammalianPromoterminimal CMV promoter with tetracycline operatorAvailable SinceApril 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pBT272_(pRosa26-GTET)
Plasmid#36882DepositorInsertsGFP
tTA2
beta-globin intron
Neo
tdT-3Myc
insulator
diphteria toxin A
Tags3 Myc tagsExpressionMammalianMutationdeleted nucleotides after nucleotide 274, inserti…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 30, 2012AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-tetOn-IRES-G418 (EtO)
Plasmid#84776PurposeSecond generation lenti tetracycline operator (on)DepositorInsertTET OPERATOR
UseLentiviralPromoterpTIGHTAvailable SinceNov. 15, 2016AvailabilityAcademic Institutions and Nonprofits only