We narrowed to 13,079 results for: BASE
-
Plasmid#177339PurposeC. elegans mNeonGreen co-injection markerDepositorInsertPmyo-3::mNeonGreen
TagsmNeonGreenExpressionWormPromotermyo-3Available SinceJan. 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pORANGE GFP-Grin2b KI
Plasmid#131487PurposeEndogenous tagging of GluN2b: N-terminal (amino acid position: S34)DepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLenti NL
Plasmid#113450PurposeLentiviral NanoLuc control expression vectorDepositorInsertNanoLuc
UseLentiviral and LuciferaseTagscmycExpressionMammalianPromoterhUbCAvailable SinceAug. 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pafG-CBE-3T
Plasmid#220374Purposefor hA3A-nCas9 and gRNA expression in Aspergillus flavusDepositorInsertshA3A-nCas9
tRNA and gRNA scaffold
UseCRISPRPromoterPtef1 and tRNAAvailable SinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJMP3
Plasmid#79875PurposeBacillus subtilis sgRNA expression vector; integrates into thrCDepositorInsertsgRNA RR1
UseCRISPRExpressionBacterialPromotervegAvailable SinceSept. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
dCas9-ddMSK1
Plasmid#165603PurposeExpresses Sp dCas9 fused to truncated inactive human MSK1 (42-802, D195A, D565A)DepositorInsertS. Pyogenes dCas9 with c-terminal truncated inactive human Mitogen- and stress-activated protein kinase-1 (42-802, D195A, D565A) (RPS6KA5 Human, S. Pyogenes, Synthetic)
UseCRISPR and LentiviralTagsFLAG TagExpressionMammalianPromoterEF1aAvailable SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLJM1-B-GRAM-W-NeoR
Plasmid#211710PurposeLentiviral expression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W)DepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
UseLentiviralTagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
B-GRAM-W
Plasmid#211707PurposeExpression of a dimerization-dependent fluorescent protein (ddFP) subunit (B) fused with the GRAM domain of GRAMD1b carrying a G187W mutation (B-GRAM-W) in mammalian cellsDepositorInsertB-tagged GRAM domain of GRAMD1b/Aster-B (GRAMD1B Human)
TagsddFP-B3ExpressionMammalianMutationChanged Glycine 187 to TryptophanPromoterCMVAvailable SinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV -HA-Luciferase
Plasmid#227802Purposeexpressing HA tag and the coding sequence of luciferase by the constitutive CMV promoterDepositorInsertHA-Luciferase
UseAAVPromoterCMVAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only